I need parts d, e and f solved please Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, whichhappens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS)after the promoter (in yellow) and proceeds in the direction of the arrow. Transcription stops atthe end of the Transcription Terminator sequence on the right (in blue).1.TSS5' -СТАТАAGAGCCATGCATTATCTAGATAGTAGGCTCTGAGAAТТТАТСТСАСТ-3'3'-GATATTTCTCGGTACGTAATAGATCTATCATCCGAGACTCTTAAATAGAGTGA-5'Which strand of DNA shown, the top or the bottom, is the template strand? Explain*briefly whya)b)Which strand of DNA shown, the top or the bottom, is the coding strand?c)Write the first 10 bases of the sequence of the mRNA produced from this gene? Labelthe 5' and 3' ends?If a mutation were found where additional five G/C (top/bottom) base pairs wereinserted immediately after the T/A base pair shown in bold in the DNA, what would bed)the effect on the size of the mutated mRNA?If a mutation were found where 5 base pairs were deleted immediately after the T/Abase pair shown in bold, in the DNA what would be the effect on the size of the mutatedMRNA?If a mutation were found where 5 base pairs were deleted upstream or before thetranscriptional start site, in the promoter region. What would be the effect on geneexpression? Explain briefly.f)

The mutation is a sudden and heritable change in the sequence of an organism's genome that gives…

If a mutation were found where additional five G/C (top/bottom) base pairs were inserted immediately after the T/A base pair shown in bold in the DNA, what would be the effect on the size of the mutated mRNA? If a mutation were found where 5 base pairs were deleted immediately after the T/A base pair shown in bold, in the DNA what would be the effect on the size of the mutated mRNA? If a mutation were found where 5 base pairs were deleted upstream or before the transcriptional start site, in the promoter region. What would be the effect on gene expression? Explain briefly. f)

If a mutation were found where additional five G/C (top/bottom) base pairs were inserted immediately after the T/A base pair shown in bold in the DNA, what would be the effect on the size of the mutated mRNA? If a mutation were found where 5 base pairs were deleted immediately after the T/A base pair shown in bold, in the DNA what would be the effect on the size of the mutated mRNA? If a mutation were found where 5 base pairs were deleted upstream or before the transcriptional start site, in the promoter region. What would be the effect on gene expression? Explain briefly. f)

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

I only need the correct answer fast please
can you help me with my homework Need help with the problem below
all the letters?asap
I’m having trouble with a intro cellular respiration and it due today, can someone help he with this. This place only answers small questions please help
I've attached a picture. I just need to match the letters to the structures. Thanks!
Hi there! Would you be able to assist with this question?
Can you help me with this picture