Identify the term that does not belong per number. 7. 1 respiratory rate Į blood CO2 Alkalosis Acidosis 8. Acidosis Carbonic acid Hypoventilation co, buildup 9. Acidosis Hyperventilation Hypoventilation CO2 buildup 10. Apnea Cyanosis ! 02 11. pH † blood CO2 Acidosis blood H*

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: O 100% O 75% O 50% O 0%

A: The genotype in case of normal vision  will be symbolized by (XX), and colour blindness by (XX). X…

Q: Put the molecules in the right category for Cellular Respiration Reactants (What goes IN to the…

A: This is the reaction of Cellular Respiration where oxygen is combined with the food molecules by the…

Q: can u please answer #9

A: The alimentary canal is the passage through which the food passes from the mouth to anus during the…

Q: I am a bit confused on why you switched the correct and incorrect statements. Could you clarify?

A: In genetics there are two types of alleles that are in charge of imparting the phenotypic effects on…

Q: Gioe beovres die/ge drde or rlaun HG- tikad Alaa ktat Tiwan prdar cal lele steat i Aart atoe…

A: Since we only answer one question at a time, we’ll answer the first one (flow chart). Please…

Q: FLG I_ K

A: Human muscular system:The muscular system is made out of particular specialized cells known as…

Q: What are they? Can you answer it?

A: They are different types of cells present  in body such as blood cells, bone cells and muscle cells…

Q: Please help me answer this question

A: A compound of hydrogen and carbon, such as any of those which are the chief components of petroleum…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: When part of a nucleotide in a nucleic acid chain, which of the following may base pair with uridine…

A: Uridine is a major form of pyrimidine nucleotide, from which cytosine and uracil are derived. It is…

Q: I’m Spanish and I’m learning English. I received this email from my professor: I will be out…

A: It's a future tense in English  , yes ,  no class tomorrow .

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: I am having trouble with these qustions can you help

A: We are answering all parts of first image . For second  image kindly repost.

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Excitation-Contraction Coupling Phase in a Practice by drawing in circled numbers in the images…

A: Skeletal muscle is controlled by neurons. The neurotransmitter gives signal to muscle for…

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase)  Mitosis is a type of cell division in which a cell…

Q: O O C

A: Inheritance or heredity is passing on one trait from the parents to the progeny by either asexual or…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: Can someone help me plz

A: Photosynthesis is the process by which green plants and certain other organisms transform light…

Q: スイ PS スF CHT Z5

A: Step 1 Every cell has the power to grow and divide to form new cells of the same kind. At the time…

Q: I letters

A: Differential stain is used is Gram stain. Gram stain uses two dyes Crystal violet and safranin. It…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: RrYy X RrYy

A: RrYy X RrYy Parent 1= RrYy Parent 2= RrYy Gene 1 Alleles=Rr Gene 2 Alleles=Yy

Q: Please I need help understand which it is

A: Hormones are chemical compounds that are usually released by endocrine glands of the body and have a…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Adding | [ Select ] to the media will increase the germination rate of seeds the type typically…

A: Seed germination is a process in which a plant emerges from a seed under favourable conditions of…

Q: How does the drug interfere with the normal function of the neurotransmitter(s)? What effects are…

A: Drugs are usually used as medicines to help pateints to cope with illness like insomnia, depression,…