Identify the major physiological and pharmacological actions of glucocorticoids on energy metabolism, on the carbohydrate, fat and protein metabolism, on the cardiovascular system, on the immune system, on the central nervous system, an on other endocrine systems that complement the metabolic effects to promote survival of the organism (gastrointestinal tract, surfactant, bone metabolism and growth
Q: List at least one reason why arteriole vasoconstriction helps mammals function and survive
A: *The arterioles main function is to regulate the blood flow r intravascular pressure bu undergoing c...
Q: The locations of numerous lacI - and lacIS mutations have beendetermined within the DNA sequence of ...
A: c. LacIs is a trans-dominant mutation that stops transcription in both operons. Only the genes cis t...
Q: I. Apply your knowledge on the basic structure of amino acids by creating a polypeptide chain that i...
A: The amino acids are the basic structural unit of proteins that contain an alpha carbon which contain...
Q: Which type of bone has a net-like appearance? Group of answer choices Cortical/Compact Bone No answe...
A: Bones are the structure which help in the formation of the structural unit of the body .
Q: Can you help me identify the specific structure pointed
A: This is transverse section of kidney. The labelled pointed section attached below.
Q: How is the structure of a macromolecule represented in its cryo EM image? Explain the differences be...
A: Cryo-electron Microscopy is also known as cryo-EM. It helps in examining the protein/Biomolecule str...
Q: A tree grows and increases its mass. Explain why thisis not a violation of the law of conservation o...
A: Atoms are the smallest things that are designed to be considered as the basic building blocks of the...
Q: Question is attached
A: The lac operon is an Operon or a collection of genes with a single promoter. The genes in the operon...
Q: Which of the following statements are true for root endodermis? I. Endodermal cells constitute the ...
A: Root endodermis is the inner boundary of cortex which is a single layer of cells outside the vascula...
Q: Please help me to graph this please please don't reject I have to do it now I am screwed if you reje...
A: The study and use of statistical approaches to a broad variety of problems in biology is known as bi...
Q: Sexual reproduction introduces genetic variation more frequently than asexual reproduction. Which pr...
A: In Asexual reproduction only single parent is involved in producing offspring because of that offspr...
Q: 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with ...
A: The given circular DNA data indicates that amoeba is closely related to ancestral cell however lizar...
Q: Standard of precautions provide guidelines for the purpose of; I. Eliminating the source of infectio...
A: Standard of precautions provide guidelines to prevent spreading of disease transmission (patient to ...
Q: Explain The Discovery of CRISPR ?
A: The common technology that can be used to edit genes is refers as the CRISPR. In other words you c...
Q: Give your response to the following statement: “Eventually, all species become extinct. So it does n...
A: All the species present in a community interact with each other for resources.
Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...
A: Epistasis occurs when the expression of one gene is influenced by the activation of one or more gene...
Q: Please help explain this LAPTM5 Transport HIV-1 Env to the lysosome for degradation
A: Answer
Q: What is spacer acquisition ?
A: Spacers are short sequence sections which look like phage or plasmid DNA. Every spacer is surrounded...
Q: 1. Which of the following drugs is not a cardioselective beta-blocker? * A. Esmolol B. Atenolol C. P...
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: 1. A short-day plant flowers only when exposed to light for less than 12 hours long. Which of the fo...
A: Short day plants When the days are shorter than their critical day length, these plants begin to bl...
Q: Thomas Malthus argued that human populations grow faster than the resources they depend on true or ...
A: Evolution is the gradual process, Biodiversity is the result of evolution. Evidence for evolution ca...
Q: Auxin causes the bending of shoot toward light by?
A: Auxin class of plant hormones plant-growth regulators) with some morphogen-like characteristics. Au...
Q: 6. Peptide bonds link many amino acids into chains of subunits that make polypeptides, or proteins. ...
A: Peptide bond Peptide bond is a type of covalent bond present in between two molecules of amino acid...
Q: What is the process in the plant life cycle that occurs within sporangium and results in spores?
A: There are four stages in the life cycle of a plant: seed, sprout, a little plant a mature plant
Q: 1. Is a microscope an absolute necessity for studying microorganisms? Why or why not? 2. What do you...
A: 1:-Naked eyes have limitations to see object, they can't see the object having size less than 100mic...
Q: How many hosts does Schistosoma japonicum need to infect to complete a life cycle? Which life-histor...
A: Answer : Schistosoma japonicum need to infect to complete a life cycle in two hosts. Namely the pa...
Q: During which phase does cytokinesis begin? What cell parts migrate to the poles during prophase? Wha...
A: Cell division in eukaryotes can be either mitosis or meiosis. Mitosis is an equational division in ...
Q: Why is the last asymmetric carbon used to establish D/L configuration? Is this an arbitrary choice o...
A: In carbohydrates, those molecules show mirror image is known as enantiomers. It shows absolute conf...
Q: Explain why living things need to reproduce and discuss the types of reproduction
A: Reproduction is the process by which an independent individual is brought into existence by a preexi...
Q: Which parameter from the software must you adjust in order to permit gene flow? Starting frequency ...
A: Definition: Gene flow is the movement of gene from one organisms to another one. It can be in a hori...
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: what advantages do regulatory systems provide to the organisms?
A: Introduction :- The neurological system and the endocrine system work in tandem to control and coord...
Q: . How would you reply to someone who argues thatwe should not worry about the effects that humanacti...
A: Natural resources and deterioration of environment is the major problem which leads to lot of seriou...
Q: What advantage does compartmentalization provide to a large and complex cell
A:
Q: In humans, brown eyes (B) are dominant over blue (b)*. A brown-eyed man marries a blue-eyed woman an...
A: Genotype: An organism's genotype is its entire set of genetic material. The alleles or variants that...
Q: Which biomes are best suited for (a) raisingcrops and (b) grazing livestock? Use the threescientific...
A: A biome is a huge region that is distinguished by its plant, soil, climate, and animals. Aquatic, gr...
Q: Which of the following are bones of the appendicular skeleton? (Choose all that apply) Group of answ...
A: Introduction: Appendicular skeleton system consists of the limbs (along with the limb bones and gird...
Q: In the figure above, structure A is and structure B is
A: The corti is a complex epithelial structure in the cochlea that contains hundreds of hair cells and ...
Q: A study by the CDC reported that only 73% of children in some areas of the United States are being a...
A: Vaccination is the procedure of injecting a lesser pathogen or a disease's weakened antigen into a h...
Q: Describe one medical/ethical issue that was raised in your lifetime involving politics. How was poli...
A: In light of the recent pandemic that has created shockwaves globally, disruptions pertaining to the ...
Q: Contrast positive versus negative control of gene expression?
A: Introduction :- Gene expression is the process through which information from a gene is used to crea...
Q: Which of the following drugs would least likely cause mydriasis? Cyclopentolate Isoproterenol Epine...
A: 1.The drugs Isoproterenol,epinephrine,Atropine, Glycopyrrolate are cause mydriasis. Answer is 1 for ...
Q: PART I. THE THEORY OF EVOLUTION. DIRECTIONS: Complete the paragraph about evidence of evolution by c...
A: Introduction :- The theory of evolution is founded on the assumption that all species are connected ...
Q: Define natural capital. Define natural resourcesand ecosystem services, and give two examples ofeach...
A: "ANSWER Natural capital refers to natural assets that provide natural resource inputs and environm...
Q: Explain this please LAPMT5 restricts HIV- 1 infection
A: Answer
Q: Explain the process of electron transfer phosphorylation
A: The electron transport chain (ETC) is the final step of aerobic cellular respiration.
Q: The expression of antigen A or antigen B in red blood cells requires the help of an H antigen. A rec...
A: Given information Antigen A and antigen B in red blood cells need H antigen for expression. A reces...
Q: Define genome, gene, and nucleic acid
A: Genome, Gene and nucleic acid are part of genetics. These provide the proper study of characteristic...
Q: How would you respond to someone who says thatbecause extinction is a natural process, we shouldnot ...
A: Extinction is the death or extinction of a species in biology. When a species' population diminishes...
Q: discuss Euthanasia as an ethical and unethical measure
A: Humans are created in God's likeness, and hence have intrinsic worth or value that transcends all co...
) Identify the major physiological and pharmacological actions of glucocorticoids on energy
Step by step
Solved in 3 steps
- МЕТАВOLISM A) Identify the risk factors of diabetes and risk reduction strategies. B) Explain the implications of obesity and prevalence of diabetes. C) Identify signs and symptoms of hyperglycemia and diabetic ketoacidosis.15.18) Determine whether the following statements describe insulin, glucagon, or both insulin and glucagon. a) secreted by pancreas both insulin and glucagon b) released when blood glucose concentration is high insulin c) released when blood glucose concentration is low glucagon d) immediately increases the amount of glucose entering cells insulin e) is a hormone both insulin and glucagon f) lowers blood glucose concentration insulin g) not enough is produced by individuals with type-1 diabetes insulin h) stimulates glycogen breakdown (glycogenolysis) glucagon EXPLANATION: When insulin binds to liver and muscle cell receptors, it triggers a series of events that result in the activation of an enzyme in the glycogenesis pathway and the inhibition of an enzyme in the glycogenolysis pathway. Glucagon has the opposite effect of insulin on liver cells; it accelerates glycogenolysis and suppresses glycogenesis causes a decrease in blood glucose levels • accelerated by insulin suppressed by…List four general categories of metabolic supplements.
- Identify A drug that has analgesic, antipyretic, and anti-inflammatory properties, which acts by inhibiting the cyclooxygenase, an enzyme responsible for the conversion of arachidonic acid into prostaglandin.Alpha-glucosidase inhibitors are contraindicated in all of the following cases, except:A. Diabetic ketoacidosisA. Liver cirrhosisB. HypertensionC. Large abdominal herniasD. Ulcerative colitisWhat is the structural difference between insulin produced by the body and synthetic insulin given to diabetes patients? Provide images, description and explanation.
- 5. There is an expression: diabetes mellitus is «hunger among abundance. What metabolic changes in diabetes confirm the validity of this statement? For answer: 9.8. Metabolic Changes in Diabetes Mellitus 535 a) list the main causes of metabolic changes in IDDM; b) enumerate the tissues with the main energy sources metabolism procceding according to this type of starvation; c) name the metabolic pathways that are activated and inhibited in these tissues, and explain why; d) list the symptoms of diabetes mellitus, that reflect such metabolic changes; c) draw a diagram of one of the mctabolic pathways that is activated in the liver under these conditions and explain the consequences of such activation.Outline the functions of the following hormones in relation to digestion and/or the maintenance of metabolic balance: gastrin, cholecystokinin (CCK), insulin, glucagon and leptinA patient with type 2 diabetes wants to improve their blood glucose control through dietary changes. Which of the following strategies would best align with current dietary recommendations for managing blood glucose levels? A) Consuming primarily protein-based meals to avoid carbohydrates.B) Adopting an exclusively high-fat, low-carb ketogenic diet.C) Incorporating a consistent carbohydrate diet with a focus on low glycemic index foods.D) Eliminating all forms of sugar, including fruits and whole grains, from their diet.
- A patient with type 2 diabetes wants to improve their blood glucose control through dietary changes.Which of the following strategies would best align with current dietary recommendations for managing blood glucose levels? A) Consuming primarily protein-based meals to avoid carbohydrates.B) Adopting an exclusively high-fat, low-carb ketogenic diet.C) Incorporating a consistent carbohydrate diet with a focus on low glycemic index foods.D) Eliminating all forms of sugar, including fruits and whole grains, from their diet.Explain the impact of nitrosamines ?Why are glucocorticoids are often used therapeutically to treat inflammation, lung disease, and other disorders?