Answered: Identify the following…

Identify the following glycerophospholipid, which helps conduct nerve impulses in the body, as a lecithin or cephalin, and list its components & label the components onto the structure

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter4: Management Practices For Finfish

Section: Chapter Questions

Problem 23SA

See similar textbooks

Related questions

Q: 1- Deducing Glycerophospholipid Structure from the Molar Ratio of its Components: Complete…

A: Glycerophopholipid is a type of phospholipid found in some membranes.

Q: One of the following polymers are intracellular O Heparin sulphate O Keratan sulphate O Hyaluronic…

A: A proteoglycan consists of a core protein that is attached covalently to a glycosaminoglycan chain.…

Q: The following sattements are true for glycogen. EXCEPT: Branching of α(1→6) linkages every…

A: Glycogen can be defined as a multibranched polysaccharide. It functions as a storehouse of energy in…

Q: Which classification of lipid(s) can contain amino alcohols? A) Waxes B) Triacylglycerols C)…

A: Lipids are of great importance to the body as the chief concentrated storage form of energy, besides…

Q: Unlike many fats and oils, the cocoa butter used to make chocolate is remarkably uniform in…

A: Glycerol is trihydroxy alcohol. Fatty acids contain a single carboxyl group that is attached to a…

Q: Using skeletal structures, draw the structure of a simple triacylglyceride containing 1…

A: A triglyceride is an ester derived from glycerol and three fatty acids.

Q: Draw the stereoisomers of the following amino acids. Indicate pairs of enantiomers and pairs of…

A: Isomers are molecules with the same molecular formula, but they differ in functional groups,…

Q: Look at the structure of the disaccharide shown. Name the type of bond which is present. CH2OH H он…

A: Disaccharides exist in more than one chemical conformational structure. The alpha and beta forms of…

Q: What two types of glycosidic bonds must be hydrolyzed to break amylopectin down into individual…

A: Glycosidic bonds: A type of covalent bond that links monosaccharides with one another or with…

Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…

A: Phospholipids have a glycerol backbone and are the major constituents of the cell membrane.

Q: Illustrate the asked organic compounds in the first picture. In the second picture, name the…

A: Isomaltose is composed of 2 molecules of glucose that are joined together through the formation of…

Q: H2C-OH HC-OH Hyč-OH myristic acid glycerol HO alpha-linolenic acid HO-P-o он orthophosphate но" NH2…

A: Introduction The principal components of the plasma membrane are lipids i.e. cholesterols and…

Q: Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole…

A: Lipid structure is composed of glycerol molecule which was attached to three fatty acid molecules…

Q: Figure 1 shows the melting temperature vs chain length of stearic acid, i.e. octadecanoic acid. 90 -…

A: Melting point- It is a point or temperature at which a material changes it's state from solid to…

Q: Match lipid descriptions in column A with the phospholipid type in column B ✓ H is attached to the…

A: Membrane is composed of phospholipids whose structure has polar head group & non-polar tails.…

Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…

A: Sphingolipids have 18-carbon amino-alcohol backbone, sphingosine.

Q: How is the cyclic formula formed in glucose or fructose? What is the position of the glycosidic…

Q: Refer to the given lipid structure: CH,(CH,),,CH=CH-CH-OH CH,OH QH CH-NH-C-(CH,),,CH, CH2 ÓH 1.…

A: Triglyceride is formed by glycerol alcohol and 3 fatty acids. Alcohol is glycerol which contains the…

Q: Match the following Class of Proteins with their corresponding Prosthetic Group Components. nucleic…

A: Prosthetic groups are organic and can be inorganic in nature but are not protein. These are tightly…

Q: Complete hydrolysis of a glycerophospholipid yields glycerol, two fatty acids (16:1(Δ9) and 16:0),…

A: Phospholipids are a class of lipids composed of glycerol which carries a hydrophilic polar head…

Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…

Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…

A: Sphingosine is composed of an amino alcohol head group, with two hydroxyls, and one amino group…

Q: Write the saponification reaction of the following triglyceride with NaOH Н-С-О CH3 H-C-O- `CH3…

A: Triglycerides, also known as fat molecules, are composed of long chains of fat. In the presence of…

Q: Which of the following linkages is found in sphingolipids? a. sphingosine-choline-phosphate b.…

A: Ans- Sphingosine - Phosphoric acid - Choline is present within the Phosphotidyl Choline…

Q: Classify the following species as saponifiable /non-saponifiable Simple glycerides Waxes…

A: Saponifable lipids are those that have long-chain fatty acids that are linked to the alcoholic group…

Q: H3C, ОН CH3 СООН CH3 H OH Cholic acid is a component of human bile whose function is to aid in the…

A: Cholic acid is insoluble in water. It is a crystalline solid in nature. It is used for the digestion…

Q: Draw the structures of all the possible triacylglycerols that can be formed from glycerol with…

A: Triacylglycerol is made up of glycerol and three fatty acids. Stearic acid is a 18 carbon saturated…

Q: The triacylglycerol shown below is: II SH-O-C-(CH,),,CH; CH-O-C-(CH,),CH=CH(CH,),CH,…

A: The triacylglycerol (TAG) is a type of lipids that are produced by the esterification of 3 fatty…

Q: glycerophospholipids have a head ans two tails structure give the chemical identity of the head and…

A: Glycerophospholipids are an essential component of the plasma membranes. They are known as…

Q: The following sattements are true for glycogen. EXCEPT: O Like amylopectin, glycogen gives a…

A: Extra glucose is stored in the liver and muscles when the body has too much. Glycogen is the name…

Q: Sphingolipids can contain of all of the following except A. glycerol. B. sphingosine. C.…

A: Sphingolipids are composed of sphingoside base to which fatty acid is linked through amide bond.…

Q: Identify the structures shown as glycerophospholipids or sphingolipids.

A: Lipids are not polymers. The simplest form of lipid is fatty acids that are a long chain…

Q: After the removal of all sugar units from a ganglioside, what molecule remains? A. sphingosine B. a…

A: Lipids are one of the 4 major biomacromolecules, known for their easily distinguishable hydrophobic…

Q: Biological waxes are composed of ____________________. glycerol and only one fatty acid…

A: Waxes are a class of lipids and are important from physiological perspective.

Q: 1. Draw the structure of the following fatty acids: (a) Stearic acid (b) Arachidonic acid 2. Draw…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Which of the following amino acids can interact via ionic/electrostatic interactions with lysine at…

A: The amino acids contain different side chains or functional group (R group) that may be uncharged or…

Q: 7.7 Triacylglycerols with a higher content of saturated fatty acids have higher melting points to…

A: "Since you have asked multiple parts of the same question, we are eligible only to answer the first…

Q: 1. aarachidnonic acid is the amjor starting material for eicosanoids 2.both gylycoholic and…

A: Arachidonic acid is a polyunsaturated omega-6-fatty acid present in the phospholipids. Eicosanoids…

Q: Using skeletal structures, draw the structure of a simple triacylglyceride containing 1…

A: A triglyceride (TG, triacylglycerol, TAG, or triacylglycerol) is an ester made up of glycerol and…

Q: When bonding 1 glycerol molecule, with 3 fatty acid molecules, you can build a tryglceride. In…

A: Triglyceride molecules lies in the category of lipids. This form of fat is stored in case of extra…

Q: The following sattements are true for glycogen. EXCEPT: Branching of a(1→6) linkages every 8-12…

A: Answer 1st and 2nd options are true

Q: Olestra has been used in certain snack foods as an alternative to fats and oils. Its structure…

A: Olestra is a fat substitute. This is not a triglyceride or triester but is made of eight fatty acids…

Q: Draw the structure of a phosphoacylglycerol that contains glycerol, oleic acid, stearic acid, and…

A: Introduction: Lipids are water-insoluble that are not a polymer like other biomolecules such as…

Q: Arachidonic acids * A. Linoleic polyunsaturated omega-6 fatty acid is its starting material. B.…

A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain of…

Q: Draw the structure of a simple triacylglyceride containing 1 eicosapentaenoic acid, 1 myristic acid,…

Q: Name the three digestible disaccharides we talked about. What monosaccharides are they each made of

A: Disaccharides are the simplest and most common oligosaccharides. A disaccharide consist of two…

Q: Classify the following compounds according to type of lipids. Choices: Simple, Complex, Derived…

A: Lipids are compounds which are insoluble in water but are soluble in organic solvents. They makeup…

Q: Glucose polymers: Which of the following is/are FALSE? a. Beta-glycosidic bonds are found in starch,…

A: Glucose Glucose is a six carbon compound which act as monomeric unit for many polymer like…

Q: one of the following is True regarding glycogen O The three dimensional structure of non-branched…

A: Carbohydrates play an important role in plants and animals. In animals, they provide energy. They…

Concept explainers

Metabolic pathways

Metabolism is defined as the group of life-supporting, enzyme-mediated chemical reactions in organisms. A metabolic pathway is a set of these chemical reactions that involve anabolism (synthesis of complex biomolecules) and catabolism (breakdown of biomolecules into small molecules) that occur inside a cell. Metabolites are the reacting substances, products, and intermediate substances of an enzymatic process that are altered by a series of chemical events catalyzed by enzymes.

Question

Identify the following glycerophospholipid, which helps conduct nerve impulses in the body, as a lecithin or cephalin, and list its components

& label the components onto the structure

CH— 0—с— (CH)14 — СH3
||
CH—0—С— (CH)16 — СH3
CH3
||
CH2-0-P-0-CH2-CH,--N-CH3
CH3

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
Give the correct names for the types of sugars shown below: a. b. CHO HO- -H € H- -OH CH₂OH HO- HO- HO- H- CHO -H -Ċ- -H -C-H -OH CH₂OH
Please answer letter “d)” ASAP please!
н но- Н о CH ОН -H ОН CH₂OH Cu2+ (aq)
Name A,B, C, D,E, F, G, H, I , J, K
TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG-T GA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-A TG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG-CTG- AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: USE "-" TO SEPARATE CODONS, NO SPACES) b. Determine the amino acid sequence after translation (USE TO SEPARATE AMINO ACIDS, NO SPACES): c. What are the Start and Stop codons in the mRNA?
1. W-h-a-t- -d-o- -y-o-u- -t-h-i-n-k- -i-s- -t-h-e- -p-h-y-s-i-c-a-l- -a-n-d- -m-e-n-t-a-l- -h-e-a-l-t-h- -B-e-n-e-f-i-t-s- -o-f- -p-l-a-y-i-n-g- -v-ol-l-e-y-b-a-l-l-?- 2. G-i-v-e- -t-h-e- -i-m-p-o-r-t-a-n-c-e- -o-f- -b-a-l-l- -c-o-n-t-r-o-l-,- -s-e-t-t-i-n-g- -t-h-e- -b-a-l-l- -a-n-d- -s-e-r-v-i-n-g- -t-h-e- -b-a-l-l- -i-n- -p-l-a-y-i-n-g- -v-o-l-l-e-y-b-a-l-l-?-
Which of the following images show a carbohydrate? Note: molecular biologists have many different ways of drawing organic molecules. Click here for a cheat sheet about how to interpret different kinds of diagrams. CH2OH OH ОН ОН оннн ннн нннн ннннн н-о-с-с -с-с-с-с-с-с-с-с-с-с-с-с-с-с-н нннн ннн нннн нннн
Match letter to name
Plsss help
1) S-Tu-U 2) S-U-Tu 3) Tu-S-U 4) U-S-Tu
HN NH₂ N N D H₂N HN CH₂ B N NH