The following is a chemical representation of a cis-unsaturated fatty acid saturated fatty acid caterpillar trans-unsaturated fatty acid
Q: Give the IUPAC name for each compound. Part 1 of 4 H,C HO H -CH,CH,CH, 2-Pentanol ྾ 6 Part 2 of 4 OH…
A: Step 1: Step 2:If long chain has 5 carbons called pent 6 carbons hex 7 carbons hept Step 3: Step 4:
Q: A specific single nucleotide variant in the human genome occurs with a 5% frequency in the general…
A: In the given question, the keywords we need to understand is that the variant does not change the…
Q: I need help filling in the boxes
A:
Q: The chemical compound cyanogen burns with a flame that has a temperature of about 8,177 degrees…
A:
Q: Glucose 6-phosphate is also a precursor for the synthesis of nucleotides that are used to build DNA…
A: Approach to solving the question: Detailed explanation:To determine which enzyme, if present in your…
Q: III. Calculate the absolute errors and the percent relative errors for each of the following using…
A: Feel free to ask for further explanation!
Q: What is this product?
A:
Q: Figure A and Figure B show two different molecules. Which of the following statements are true about…
A: "Figure A shows one polar head from the charged phosphodiester"This is incorrect Feel free to…
Q: Convert the cyclic form to an acyclic monosaccharide. Use the Fischer projection carbon drawing tool…
A: In the cyclic form of monosaccharide, the hydrogen of -OH is moved to the oxygen of -CHO and forms a…
Q: None
A: Answer information:Step 1:The objective of this question is to draw the significant resonance…
Q: Genomic sequencing cannot be used to: Predict a protein coding gene Predict structure and function…
A: Genomic sequencing can be used for tasks such as predicting protein-coding genes, analyzing protein…
Q: Which of the following processes is dependent on the activity of pentose phosphate shunt?…
A: The pentose phosphate pathway, or the pentose phosphate shunt, plays a crucial role in several…
Q: Perform a peptide coupling reaction to connect the two amino acids together plus if any other…
A: Detailed explanation:To perform the peptide coupling reaction for connecting the two amino acids,…
Q: Glut4 is a glucose transporter expressed in certain cells - it is only found on the cell surface…
A: Glut4 is a glucose transporter that is sensitive to insulin and its presence on the cell surface is…
Q: Which compound(s) is/are a-hydroxy acids? Check all that apply. سللا OH ẞ-hydroxy-3-methylbutyric…
A:
Q: The belief that rare mutations within a single cell allow it bypass growth barriers to become…
A: Driver Mutations: These are genetic changes that directly drive growth to cells, allowing them to…
Q: Select all that applies
A: To ensure that all of the 14C label is released as 14CO2 during fermentation, the 14C label must be…
Q: 14. Below is a diagram of the "Fates of Pyruvate." One "fate" we have not covered yet (conversion to…
A: Pyruvate is converted into lactate (A) by enzyme lactate dehydrogenase (B). During this process, the…
Q: Glycogen synthesis and breakdown are most common in the liver and muscle. A very rare human disease…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: (b) ☐ The exergonic reactions catalyzed by isocitrate dehydrogenase (ICDH) and α- ketoglutarate…
A: Isocitrate Dehydrogenase (ICDH): Function: ICDH plays a crucial role in the TCA cycle by catalyzing…
Q: Helpp 1
A: Here is a more detailed step-by-step algorithm for global sequence alignment:Step 1:…
Q: 0 A chemist dissolves 690. mg of pure nitric acid in enough water to make up 400. mL of solution.…
A: Step 1: Nitric acid, or HNO3, is a powerful monoprotic acid. In water, it can fully dissociate into…
Q: URGENT Cisplatin si a compound, hypothesized to target mammalian Cytochrome C, localized ni the…
A: The experiment is designed to investigate the effect of Cisplatin on the mitochondrial electron…
Q: RNA is composed of single strand polynucleotide polymer. Explore the structure of RNA further. RNA…
A: Ribose is a sugar that serves as the structural basis for ribonucleic acid (RNA), a crucial…
Q: A fragment of DNA that was cut with a restriction enzyme has a 3’ overhang. This overhang is…
A: Restriction Enzymes: These enzymes identify certain DNA sequences, known as recognition or…
Q: explain what the red box (figure 1) is showing. the figure 1 description is confusing please help me…
A: Title: Insights into the Structure and Assembly of Human Astrovirus: A CryoEM StudyAbstract:Human…
Q: In glycolysis, fructose 1,6-bisphosphate is converted to two products with a standard free- energy…
A: under what cellular conditions the free-energy change (ΔG) will be negative, we need to consider the…
Q: Which factor is LEAST likely to result in protein denaturation? ○ altering net charge by changing pH…
A: The factor least likely to result in protein denaturation among those listed is changing the salt…
Q: please help with this
A: Option 1 (AUCAUUCUAUUGUCCUCCACC) brings change in which UGA (encoding Cysteine) becomes UCA…
Q: Fill in the bases, codon, anticodon, or amino acid needed to complete the following table that…
A: Protein synthesis starts with the DNA molecule, which has two strands: the sense strand and the…
Q: 1. a. Draw the following pentapeptide: lysine-leucine-aspartate-threonine-phenylalanine b. Label the…
A: In the drawn pentapeptide, each amino acid is represented by a letter code, and the peptide bond is…
Q: Assuming ideal behavior, rank the solutions boiling points, 1 is lowest to 4 highest boiling point:…
A: Step 1:Boling point of solution is a collegiate property, which depends on the number of particles…
Q: Which of the following accurately characterize glycolysis under standard biochemical conditions?…
A: The metabolic process known as glycolysis converts the six-carbon glucose molecule into two…
Q: Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand…
A: Now, let's calculate: 1: Glycolysis produces 2 ATP.2:From oxidative phosphorylation, each NADH…
Q: Q5. Which of the following molecules best fits the following NMR spectrum? C6H12O2 8 O 5 4 ppm O OH
A: 
Q: The electronic excitation method in fluorescence and absorption spectroscopy is the same. What are…
A: In fluorescence and absorption spectroscopy, both methods involve electronic excitation of…
Q: Can I get a visual (drawn on paper or on a software; like chem draw or chem sketch)? Illustrate…
A: Activation of the SAM:Activate the carboxyl groups using carbodiimide chemistry.Reagents: EDC…
Q: A compound has a pKa of 7.4. You have made up 100 mL of a 1.0 M solution of this compound at pH 8.0.…
A: To find the ratio of the unprotonated to protonated form of the molecules, we'll use the…
Q: 2. What is the major organic product obtained from the following reaction? CH3 Brz FeBr3 CH₂Br CH3…
A: Step 1:
Q: None
A:
Q: When the amino acid sequence information and structure of a protein whose activity is unknown are…
A: Yes, inferring the activity of a protein based on its amino acid sequence and structure is a common…
Q: 4-methyl-2-pentene
A: part 1. To determine the product formed when 4-methyl-2-pentene is treated with water (H₂O) in the…
Q: Give the IUPAC name for each aldehyde.
A: Step 1: Guidelines for IUPAC nomenclature of organic compounds:Consider the carbon chain with the…
Q: can i get it drawn please?
A: The graph depicts the relationship between retention time and molecular weight. As retention time…
Q: Consider the titration of a 23.0-mL sample of 0.110 M HC2H3O3 (Ka=1.8\times 10−5) with 0.120 M…
A: volume of base required to reach equivalence point = (0.110 M x 23 ml)/0.120 M = 21.1ml of NaOH pH…
Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…
A: To decode the mRNA sequence 5'-UUG ACC GAC-3' into its corresponding amino acid sequence, we use the…
Q: You are examining the effects of a mutation in the proximal histidine of a heme-containing protein.…
A: The heme will bind to O2 more effectively than to CO: This option is incorrectThis option implies…
Q: 3. Here is a question that test your ability to understand and combine concepts. hydropathy index I.…
A: I. Would you predict this protein to contain transmembrane helices? If so, how many? Hydropathy plot…
Q: Give the IUPAC name for each structure.
A: IUPAC NAME:1. FIRST COMPOUND IS METHYL PENTANOATE. The IUPAC name for the compound METHYL VELARATE…
Q: Consider the relation between the sequences of DNA, mRNA, tRNA, and the resulting polypeptide. Part…
A: Detailed explanation: 1. The relation between the sequences of DNA, mRNA, tRNA, and the resulting…
The following is a chemical representation of a
cis-unsaturated fatty acid
saturated fatty acid
caterpillar
trans-unsaturated fatty acid
Step by step
Solved in 2 steps with 1 images
- the membrane solubility of a steroid is higher than the membrane solubility of a carbohydrate true or false?Complete hydrolysis of a glycerophospholipid yields glycerol, two fatty acids (16:1(Δ9) and 16:0), phosphoric acid, and serine in the molar ratio 1:1:1:1:1. Name this lipid and draw its structure.Describe how carbohydrates can be classified into functional group of aldoses andketoses and give one example of each group (name and structure).
- Why double bonds of fatty acids in our body are generally in cis for?Determine the class of lipid (see attached image for choices) shown by the following structures and whether if it is saponifiable or non-saponifiable.The human body uses the branched polymer glycogen for short term storage of glucose in the liver. It is broken down by the stepwise removal of the terminal glucose monomer. Explain why it is an advantage for glycogen to have a branch chain structure rather than a linear structure. (A pargraph would be great)
- Mild hydrolysis of a glycolipid produces an L-glucose molecule and the salt of tetra-decanoate fatty acid. Draw the structure of the glycolipid.functional groups in palmitic acid, a saturated fatty acid and oleic acid, an unsaturated fatty acidC17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correct
- Describe the structure of triacylglycerol (TAG) and explain the hydrolysis of TAG.Determine the class of lipid (see attached image for choices) shown by the following structures and whether if it is saponifiable or non-saponifiable.sDescribe the four functional groups of carbon 2 based on a typical saturated fatty acid.