I just need a simple answer PLS HELP Question 4AExplain why the image below could not be from a eukaryote. What characteristics of the imagewould not be seen in a eukaryote?RNA polymeraseDNAMRNAPolyribosome

Eukaryotes are organisms with a nucleus as well as other membrane-bound organelles in their cells.…

Answered: I just need a simple answer PLS HELP

Science

Biology

I just need a simple answer PLS HELP

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 8P

See similar textbooks

Related questions

Q: Meiosis

A: There are two types of cell divisions, mitosis and meiosis.

Q: Can you help me answer this?

A: The term "homeostasis" refers to the body's continuous interior environment. Stasis = standing;…

Q: Hello, please help me to get the answer. I just need simple answer NOT much explanation Thanks for…

A: Protein is a general term for a large group of organic compounds, which form the structure and…

Q: I just need D & E on this question please

A: Vancomycin is an antibiotic medicine that is used for the treatment of bacterial infections. It is…

Q: I'm going to............... all of my classmates O invites O invite O invited inviting

A: An action in the future is to be reported without the pleural noun taken into consideration.

Q: oon I need.. Thank you

A: After the birth, it is very much important to monitor the client for the presence of any…

Q: m not sure which answer would explain the problem can you please help?

A: Diversity - Ecosystem diversity refers to the variety of habitats, communities, and ecological…

Q: e EXCEPT

A: Bronchial asthama is a condition in which airway of the patient becomes inflamed, narrow , swell and…

Q: I need help with question 2 it’s urgent

A: Initial Observation: - The person (Spongebob) is suffering from an illness and is suggested by two…

Q: I need help with this problem. I don't know what i did wrong

A: Answer. Given data :--- Total volume of fluid = 500 ml. Infusion time = 6 hour. Infusion started…

Q: f you can’t answer all the parts that’s fine I’ll take what I can get!

A: Mitosis and meiosis are types of cell division. It is studied under the domain of cell biology.

Q: I need answer please quickly help

A: A profession in which the trained personnel provides preventive, promotive and rehabilitative care…

Q: h to get a like.or don't attempt plz.Thanks

A: All the efforts of individuals of a population are directed towards survival of the fittest and if…

Q: I needed help me

A: Half life of a drug is an estimte of the time it takes for the amount of the drugs active substance…

Q: I am having trouble with these qustions can you help

A: We are answering all parts of first image . For second image kindly repost.

Q: ly answer and a quicke

A: Menstrual cycle is divided in to four phases 1. Mensuration 2. Follicular phase 3. Ovulation 4.…

Q: Please answer #13. I’m having trouble with it

A: Molecules can move across cell through a variety of different processes.

Q: ||||

A: Activation energy is the minimum energy required for the reaction to initiate and this energy…

Q: Z1 PS K CH 22

A: Cell cycle is of sequential events which is responsible for dividing the parent cell into two…

Q: z1 PS z2

A: Centrioles play a significant role in cell division. They help in formation of spindle fibers and…

Q: nes smaller.

A: A flock of Darwin finches migrate to an island where seeds are large. Finches adapt themselves and…

Q: misfolded protein w

Q: Can you provide more

A: Aerated composting Composting is defined as a process in which the dead organic matter is converted…

Q: I need help

A: Digestive system: The gastrointestinal tract and additional digestive organs make up the human…

Q: I really dont understand this one I hope you can help me with this. Thank you so much. It has a 10…

A: The excess glucose molecules present in the blood are stored in the form of glycogen in the liver…

Q: I need to answer this question, Thank you

A: Ans: Potential energy

Q: Pls answer thank u

A: Genetically modified crop Genetically modified crops(GMCs crops) are plants used in agriculture,…

Q: need help asap. .?

A: The drugs must be taken at a particular concentration. It is because, when the drug is taken at a…

Q: I have provided everything needed please help me out

A: Given that, the dominant T allele is responsible for taste of phenylthiocarbamide. Let us consider,…

Q: reebop model doesn't have a twin. Please help thank you

A: Dominant trait is always expressed whether it is present in homozygous or heterozygous condition…

Q: - outerma

Q: Need help

A: Figure 1 represents Cotrimoxazole, a synergistic action of 2 drugs. Co-trimoxazole is generally…

Q: Hi I hope you're doing fine. I need help with these questions please! thank you!

A: Cell cycle: a. When a cell grows to a maximum size, it divides and undergoes a series of changes in…

Q: Please i really need the right answer there is mutiple queshtions and i need the right answer and…

A: B is the correct answer. Multiple alleles occur when there are more than two possible alleles for a…

Q: Please ASAP. Thankyou

A: Answer If a pateint is abnormally sensitive to noxious stimuli , They might be experiencing…

Q: Hi can someone help me please. The picture contains the full structure.

A: Biomolecules are organic molecules that are mainly composed of carbon, hydrogen, oxygen, nitrogen,…

Q: This part is called *

A: given here is a part of an instrument . following is its description

Q: I’m really confused on this and would really appreciate help please!

A: According to this question, the fitness of allele A is 1 and fitness of allele B is 1.5 and fitness…

Q: Is this all the correct answer? Can you explain to me, please?

A: Vertebrae are the 33 unique bones that interlock with each other to form the spinal column. The…

Q: I need help answer quickly

A: Cells are the basic structural and functional unit of all known organisms which help in the process…

Q: I N

A: As we know A fire safety management plan describes the steps you take to implement, control,…

Q: I need help label name

A: We know that The development of the embryo and of the fetus during the gestation period is known as…

Q: I don't know what is that picture. I need help with the nameof label

A: The picture describes a cell undergoing a particular stage of Mitosis. A nucleus is visible with…

Q: 4. A DE R

A: A phylogenetic tree is kind of a branching diagram or a kind of tree that shows the evolutionary…

Q: I do not get this at all can you help me out

Q: Hi there! Would you be able to assist with this question?

A: Mitosis is a type of cell division in which one cell divides to produce two daughter cells that are…

Q: Please I need a quicker response

A: Our kidneys are our body`s filters.These two bean-shaped organs are a sophisticated waste removal…

Q: eed help answering the queshtion there are multiple answers to it

A: The bonds which contribute in the formation of three dimensional structure of proteins are:-…

Question

I just need a simple answer PLS HELP

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Inhigher eukaryotes, centromeres are much more complexand contain ______________ DNA sequences.
answer all subpart to upvote because vert short question otherwise dislike Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The gene gets inserted into the bacterial genome and gets expressed in the same way that bacterial genes get expressed. A) What location in the bacterial cell would the gene get transcribed into mRNA? (1 sentence max) B) What protein complex would perform the transcription to produce the mRNA? (1 sentence max) C) Where in the bacterial cell would the gene get translated? (1 sentence max) D) What protein complex would perform the translation to produce the protein? (1 sentence max)
ture.com/courses/132776/quizzes/489888/take O Ribosome Question 22 22. During transcription, what does messenger RNA do? O It strings together two complementary RNA strands O It strings together two complementary DNA strands O It constructS proteins out of random amino acids O It delivers DNA's Instructions for making proteins Question 23
Why Yeast RNA is soluble/insoluble in:Cold WaterHot WaterEthanol Diluted HCl Diluted NaOH
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
Where does transcription take place in eukaryotes? O Nucleus O Cytoplasm O Ribosomes O O O
Match the descriptions to the molecules of transcription and translation. MRNA [ Choose ] v DNA [ Choose ] FRNA [ Choose ] TRNA [ Choose ]
2 Question Completion Status: IKNA only Ob.mRNA only Oc. rRNA only Od. mRNA and tRNA only Oe. mRNA, tRNA, and rRNA QUESTION 43 Why is only one strand of DNA transcribed into mRNA? a. Because mRNA is only required in small quantities Ob. Because the other strand would produce the same amino acid sequence in reverse order Oc. Because all genes are located on the same DNA strand, while the other strand acts as protection Od. Because the other strand is transcribed directly into amino acids e. Because transcribing both DNA strands would produce different amino acid sequences QUESTION 44 tRNA molecules are able to act as adapters between amino acids and mRNA during translation because: a tRNA binds to ribosomes. Ob. tRNA can bind to both mRNA and an amino acid. c. tRNA anticodons bind to amino acids. d. tRNA is recognized by RNA polymerase. e tRNA molecules bind to promoter sequences to initiate transcription. QUESTION 45 One of the gyrimiding bases in a DNA molecule is adenine. True 3…
Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG AAG The original template for this process is: O DNA O TRNA O FRNA O MRNA
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
MULTIPLE CHOICE QUESTION What are the correct complementary RNA bases for the strand shown here? TUUCTG UAACUG TAACTG TAACTO Rewatch
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…