Huntington disease (HD) is an inherited neurodegenerative disorder characterized by gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age, and the course of the disease can range from 15 to 20 years. The molecular basis of HD is becoming better understood, and the genetic mutation has been traced to a gene that encodes a large protein of unknown function. In individuals who will not develop HD, a region of the gene that encodes the N-terminus of this protein has a sequence of CAG codons (for glutamine) repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon (3 nucleotides) is typically repeated 40 to 55 times In those with childhood-onset HD, it is repeated more than 70 times. *codon: refers to the 3 nucleotides that code for amino acid. A small portion of the coding sequence of the HD gene is given below. The nucleotide sequence of the DNA is shown in black, the amino acid sequence corresponding to the gene is in blue (the letters at bottom), and the CAG repeat is shaded (the numbers at left indicate the starting nucleotide and amino acid residue numbers in that row). For ease of counting each row is 51 nucleotides. Design a PCR-based test for HD that could be carried out on a blood sample. Assume that each PCR primer must be 25 nucleotides long. Reagents: [Write down all the reagents you would need to carry out PCR. Include the sequence of the primers you designed and label them as forward or reverse showing the 5’-3’ orientation.]

Name: Huntington disease (HD) is an inherited neurodegenerative disorder cha
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Huntington disease (HD) is an inherited neurodegenerative disorder characterized by gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age, and

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Concept explainers

Topic Video

Question

Huntington disease (HD) is an inherited neurodegenerative disorder characterized by gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age, and the course of the disease can range from 15 to 20 years. The molecular basis of HD is becoming better understood, and the genetic mutation has been traced to a gene that encodes a large protein of unknown function. In individuals who will not develop HD, a region of the gene that encodes the N-terminus of this protein has a sequence of CAG codons (for glutamine) repeated 6 to 39 times in succession.

In individuals with adult-onset HD, this codon (3 nucleotides) is typically repeated 40 to 55 times
In those with childhood-onset HD, it is repeated more than 70 times.

*codon: refers to the 3 nucleotides that code for amino acid.

A small portion of the coding sequence of the HD gene is given below. The nucleotide sequence of the DNA is shown in black, the amino acid sequence corresponding to the gene is in blue (the letters at bottom), and the CAG repeat is shaded (the numbers at left indicate the starting nucleotide and amino acid residue numbers in that row). For ease of counting each row

is 51 nucleotides.

Design a PCR-based test for HD that could be carried out on a blood sample.

Assume that each PCR primer must be 25 nucleotides long.

Reagents: [Write down all the reagents you would need to carry out PCR. Include the sequence of the primers you designed and label them as forward or reverse showing the 5’-3’ orientation.]

307 ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC
1
358
18
MATLE KLM KAFESLKSF
CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
QQFQ O O O O O O O O O O O O O
409 CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCG
35 ооооооооорРРРРРРР
460
CCGCCTCCTCAGCTTCCTCAGCCGCCGCCG
52 P P P Q L P Q P P P
[Source: The Huntington's Disease Collaborative Research Group, Cell
72:971-983, 1993.]

Expert Solution

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions