Gene Expresslon O FIGURE 7.10 The Process of RNA Synthesis Bacterial RNA polymerases have a sigma subunit that allows them to recognize a promoter (as illustrated); the RNA polymerases of eukaryotic cells and archaea use Transcription transcription factors to recognize promoters. ? Which component of the bacterial RNA polymerase recognizes the promoter? Translation 5' 3' 3' 5' Promoter Terminator RNA polymerase 1 Initiation RNA polymerase binds to the promoter and melts a short stretch of DNA. 5' 3' 3' 5' Template strand Sigma 2 Elongation Sigma factor dissociates from RNA polymerase, leaving the core enzyme to complete transcription. RNÁ is synthesized in the 5' to 3' direction as the enzyme adds nucleotides to the 3 end of the growing chain. 5' 3' 5' Promoter RNA ETGAS Termination When RNA polymerase encounters a terminator, it falls off the template and releases the newly synthesized RNA. 5' 3' 3" 5' Promoter RNA polymerase dissociates from template.

Q: Why is the RNA polymerase/RNA/DNA duplex of the RNA polymerizing complex called transcription…

A: Transcription is the process of formation of an mRNA molecule from the DNA in the nucleus. It…

Q: bacterial RNA polymerase

A: Introduction : The DNA-dependent multisubunit RNA polymerase (RNAP) of bacteria is the most…

Q: Does RNA polymerase binds tightly to promoter DNA?

A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…

Q: Is the transcription of RNA from a DNA template perfect?

A:

Q: What is a functional consequence of RNA editing?

A: RNA editing is otherwise known as RNA modification for obvious reasons. The process deals with the…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: What would be the likely effect of a mutation that prevents σ from dissociating from the RNA…

A: After the initiation of the transcription, the RNA strand would elongate by the action of RNA…

Q: What proteins bind to a promoter?

A: The regulation of gene expression at promoter regions involves a complex interplay of diverse…

Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: When an activator protein interacts with mediator, how does this affect the function of RNA…

A: RNA polymerase is an enzyme that is responsible for copying a DNA sequence into an RNA sequence,…

Q: This diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the…

A: Transcription is the process of formation of mRNA using DNA as template. This is possible with the…

Q: Name the factor of RNA polymerase enzymes which recoganise the start and termination signal on DNA…

A: All transcription in bacteria is performed by the single type of RNA polymerase.  This polymerase…

Q: How is the template strand the one being transcribed but the coding strand is the one that has the…

A: Introduction Because it serves as a template for transcription, the DNA strand from which mRNA is…

Q: Why is an NFR needed at the core promoter for transcription to occur?

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Describe the promoter structure in prokaryotes and eukaryotes.

A: A gene's "promoter", which serves as a control point for controlled gene transcription, is a…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.