For the DNA segment 5′ TTGCAC 3′ how many of each of the following are present?  nucleotides  purine bases  phosphate groups  ribose subunit

Q: The following represents a DNA strand in the process of replication. The bottom sequence is that of…

A: DNA replication is the process in which a copy of already existing genome is formed. A pair with T…

Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…

A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…

Q: 5'-AAAAACCCCCGGGGGTTTTT-3' is in a test tube. What else needs to go in the test tube to so that we…

A: Here it is not mentioned that how the single stranded DNA is maintained. As the single strand…

Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…

A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…

Q: 37. Telomere Repetitive DNA found near the centromere of higher eukaryotes В. Specialized structure…

A: Since you have posted multiple questions, we will solve the first question for you. If you want any…

Q: 19. Chemical damage to DNA can result when alkylating agents react with one of the base pairs of…

A: Alkylating agents are those agents which bind to certain chemical groups found in nucleic acids.…

Q: How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect…

A: Before an answer is given, the process of DNA replication must be understood. First there are two…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: 11. Consider a Lambda-DNA molecule, which has 48502 base pairs and a contour length o about 16.5 um.…

A: Introduction Lambda DNA, a linear, double-stranded phage DNA containing 12 bp single-stranded…

Q: Chironomus genomic DNA contains approximately 35.5% A. Estimate the percentages of G, C, and T in…

A: The double (ds) stranded DNA duplex structure follows the chargaffs rule, which suggests that the A…

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…

A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…

Q: 40.Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA…

A: DNA replication produces two identical helices from a single helix of DNA. If we refer to the…

Q: DNA polymerase uses which of the following catalytic strategies: Group of answer choices Metal ion…

A: The correct option is Metal ion catalysis. Explanation: During the extension of a DNA strand…

Q: 31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a…

A: ANSWER;-

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…

Q: 2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide…

A: Great Biologist, Francis Crick proposed the Central Dogma in the molecular biology, which states the…

Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne…

A: Permutation infers the maximum number of possible arrangements by given things/ variables that can…

Q: 66 Comparisons of DNA sequences among humans have revealed many types of variations. Which of the…

A: DNA stands for deoxyribonucleic acid. It is a kind of macromolecule present in cell.

Q: Need question 11 answered

A: During gene cloning, the gene of interest or insert is added into the plasmid vector. This is done…

Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are the DNA digesting enzymes.

Q: DNA is made up of Group of answer choices guanine, thymine, deoxyribomucleic acids Guanine,…

A: Deoxyribonucleic acid (DNA) is a molecule that contains the biological directions that make every…

Q: What is the relationship between the free energy of supercoiling and the superhelical density? How…

A: Deoxyribonucleic acid (DNA) is a compound made up of two nucleotide bases which wrap around together…

Q: 0. The two strands of DNA that make up the double helix are held to each other by …     a)…

A: The correct option is A hydrogen bonds between guanine / cytosine, and thymine / adenine

Q: hi i need help with science homework if you do i give 5/5  if this sample is good i might even sign…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’   A. How…

A: A nucleotide consists of a sugar, a nitrogenous base and a phosphate group. A phosphodiester bond is…

Q: Ch. 15-2 Restriction enzymes in bacterial cytoplasm cut injected bacteriophage DNA wherever certain…

A: Restriction endonuclease was isolated for the first time by W. Arber in 1962 in bacteria. They are…

Q: 6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9…

A: Since you have asked multiple questions, we will answer only first question for you. In order to get…

Q: 19. atways pairs with 20. always pairs with 21. An organism is found to have 30% Thymine bases. How…

A: Nitrogenous bases in DNA always pair up together. This was observed by Erwin Chargaff in the late…

Q: Basisse triplet nommer/ Base triplet number  1  2  3  4  5  6  7  Menslike DNA-volgorde /…

A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…

Q: 19. For the helix in double-stranded B-form DNA, the majority of the stability of the DNA can be…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the…

Q: 2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide…

A: As per honor code, we only answer one question at a time, therefore, we are answering the first…

Q: 1. Define the relationship between twist, writhe and linking number. Are the twist and writhe…

A: Twist, with and Linking number are used to define the helical pattern and the orientation of dna…

Q: THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes…

A: Note: You have asked multiple sub part questions but as per our instructions we are instructed to…

Q: 6. a. The double helical structure of DNA is intrinsically unstable and easily dissociates to form…

A: Biomolecules are organic molecules that function inside living organisms. They are categorized as…

Q: 18. If 32P is used to label both strands of double-stranded DNA, after two rounds of replication,…

A: According to the semiconservative model of replication , it would produce molecules with both old…

Q: 40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and…

A: Multiple questions with three parts are asked. I will answer for the question A , as per guidelines.…

Q: 14. How many purines are there in chromosome 14 the human genome (Hsapiens), version hg19? 15. How…

A: 14. Chromosome 14 spans more than 107 million DNA building blocks or base pairs and it represents…

Q: 18 Fred Sanger developed an effective DNA sequencing technique in 1977. Thepeed at which DNA can be…

A: Fred Sanger developed DNA sequencing technique in 1977.  DNA sequencing is based on the base pairs…

Q: 34.  Give the sequence of the complementary DNA strand of the DNA chain with the following base…

A: Complementarity refers to the lock-and-key relationship between two structures. Complementarity is a…

Q: > 25 % 14 min 24 secs If a person is homozygous for the presence of an ALU repeat in the PV92…

A: Transposable elements (transposons) are jumping genes or DNA sequences that can move from one…

Q: True or False 1.) The Watson and Crick double stranded DNA structure is always antiparallel.

A: “Since you have asked multiple questions, we will solve the first question for you. If youwant any…

Q: How can we visualize the effect of supercoiling on the structure of DNA? (describe supercoiling)

A: Supercoiling (means the coiling of a coil) represents a coiling of the DNA double helix upon itself.…

Q: Describe the three-dimensional structure of DNA. 2. What is DNA denaturation?

A: a. DNA is a double-helical structure that carries the genetic information for the growth,…

Q: 3' 5' a 5' 3' C f 5' 3' 3' 5' What enzyme should be at location "c" to synthesize DNA after the…

A: DNA replication is the process by which  cell makes new copies of the DNA molecule.

Q: 1.Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.