Explain the roles of mRNA, tRNA, and rRNA in translation.

Q: What are the difference between transcription and genetic code?

A: Transcription is the process whereas genetic code is a set of rules.

Q: Describe all the elements required to carry out the process of translation.

A: What is translation Translation refers  to the process of polymerization of amino acids to form a…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…

A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…

Q: What happens in initiation, elongation, and termination during translation?

A: The translation is the process by which the proteins are synthesized. The information stored in the…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Place the steps of translation in sequence. In whatmolecules are codons and anticodons found? What…

A: Proteins are polypeptides that are made up of different types of amino acids. One amino acid is made…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Describe how mRNA is created in transcription step by step.

A: Gene expression is a cycle by which the qualities are gone on to frame RNA and proteins. This is…

Q: explain what happens in translation?

A: The process of synthesis of protein by ribosomes in the cytoplasm or endoplasmic reticulum after…

Q: Explain how mRNA plays a role in all three stages of translation.

A: Introduction: Central dogma is a two-step process and constitutes transcription and translation.…

Q: Describe the role of a release factor at the end of translation.

A: Translation is the process by which proteins are formed by reading the sequences of nucleotides…

Q: Give features of genetic code.

A: The genetic code is defined as a series of codons in mRNA. It translates the genetic information…

Q: Describe what happens to the transcribed mRNA before it can leave the nucleus and be used for…

A: Introduction Messenger RNA (mRNA):- It is a type of single-stranded RNA involved in protein…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.