Explain how evolution of organisms/populations occurs as a step by step process (underline key words you know I am looking for). Include in your answer: • Evolution • Mutation • Genetic variation • Natural selection • Sexual selection • Gene drift • Gene flow • Fitness • Phenotype • Genotype

Q: Give examples of eukaryote cells. What is the difference between prokaryotes and eukaryotes

A: Note: According to bartleby guidelines only first question is to be answered. So please upload…

Q: What is the summary of this paragraph?

A: A crucial component of human cognition and behavior is cognitive and social flexibility. Cognitive…

Q: In the image, arginine 79 is shown to be important for the stabilisation of the quaternary protein…

A: Introduction  Amino acids are the building blocks of proteins. They are organic compounds composed…

Q: Part 1 Structure A (shown below) is a monomer that functions as a building block for much larger…

A: Answer :  a). On the left side of this structure, there is an amino group(-NH2) while on the right…

Q: The enzyme complex called the oxygen evolving complex _____ Select one: a. breaks water, and…

A: Water is photo-oxidized during the light reactions of photosynthesis in the oxygen-evolving complex…

Q: How is ATP produced in chloroplasts? Select one: a. When a photon hits an ADP molecule, it is kicked…

A: Introduction :- Chloroplasts are organelles found in the cells of photosynthetic organisms such as…

Q: What are sites of mitosis in plants? Select one: a. apical meristem b. plasmodesmota c. guard cells…

A: Introduction  Mitosis is the process of cell division that occurs in somatic (non-sex) cells of an…

Q: Which of the following epidermal growth factor (EGF) receptors cannot bind ligands but will form…

A: Epidermal growth factor (EGF) is a protein that plays a key role in the regulation of cell growth,…

Q: Explain how sex and separately how age can affect the number of mutations in sex cells.

A: In humans and other animals, the cells that produce sex cells called germ cells, divide multiple…

Q: Which 2 endocrine glands exert the most control over blood calcium level: a) anterior pituitary and…

A: Introduction  Endocrine glands are glands in the body that secrete hormones directly into the…

Q: Ch 19 – Viruses and Prions Describe the lysogenic cycle of a virus. What is the difference between…

A: The lysogenic cycle is one of two ways that a virus can reproduce within a host cell. It is a slow,…

Q: The energy required for active transport processes is? How does a single celled organism perform…

A: Introduction  Transport refers to the movement of substances such as ions, molecules, or larger…

Q: QUESTION 7 Taylor requires a blood transfusion to replace the blood she lost in the accident from…

A: The ABO blood group system is a classification system for human blood based on the presence of A and…

Q: One result of X-linkage is a crisscross pattern of inheritance in which sons express recessive genes…

A: . X-linked genes are genes located on the X chromosome, which is one of the two sex chromosomes in…

Q: Many glomerular disorders exist due to the delicate nature of the glomerulus and the filtration…

A: The glomerulus is a delicate organ and the filtration barrier that it provides is easily damaged.…

Q: 20. Genome imprinting can be the result of silencing genes by methylation of promoter DNA sequences.…

A: Introduction  Genome imprinting is a process in which specific genes are epigenetically marked and…

Q: What activities of life are dependent on cellular reproduction to occur? Select one: O a Catabolism…

A: Reproduction of cells means when the cell is exactly copied and divided into daughter  cells.  There…

Q: Differentiate mitosis and meiosis.

A: In eukaryotes, there are mainly two types of cell divisions involved in partitioning of genetic…

Q: According to Darwin’s theory, organisms that are the most fit A. have the longest life spans. B.…

A: Introduction Natural selection is the process by which organisms with advantageous traits are more…

Q: 4. A linear piece of DNA has the following EcoRI restriction sites. EcoRI site 1 2 kb 4 kb EcoRI…

A: Restriction digestion is a laboratory technique for processing and analyzing DNA samples. It…

Q: What are the parts of an amino acid? How does a polypeptide chain form? How is it broken down? Why…

A: Introduction  Proteins are made of long chains of smaller subunits called amino acids. There are 20…

Q: Why might alcohol dehydrogenase metabolize ethylene glycol and how could you use ethanol to treat…

A: Ethylene glycol poisoning occurs when a person consumes or inhales the toxic chemical ethylene…

Q: Which statement is false regarding plasmids? Circular dsDNAs that reside in bacterial cells…

A: Introduction :- Plasmids are circular, double-stranded DNA molecules that are found in bacterial…

Q: Because of the mechanism of sex determination, males of many species can be neither homozygous nor…

A: * When one or more genes present they will together produces the effects qualitatively which is…

Q: Give 2 examples each of plants or fruits found in both the gymnosperm and angiosperm.

A: Angiosperms and gymnosperms  Angiosperms are known as flowering plants where as gymnosperms are…

Q: Which of the following scenarios would result in FIRM fruit or vegetable texture?  Cauliflower is…

A: Introduction  Fruits and vegetables are edible plant-based foods that are an important part of a…

Q: Please label the following: (A) INITIATION *Complementary strand *Template Strand *RNA polymerase…

A: The transcription process is shown in the following diagram. Where DNA is transcribed into RNA with…

Q: Why do you think the auditory system has so many stages of processing before the signals reach the…

A: Introduction :  One of the most sensitive body parts is the ear. It focuses primarily on hearing,…

Q: explain in detail Altered T cell function and how Ageing can also lead to changes in T cell…

A: Introduction  T cells, also known as T lymphocytes, are a type of white blood cell that play a…

Q: QUESTION 3 The Cori cycle represents a metabolic link between glycolysis and gluconeogenesis. O True…

A: Introduction  Glycolysis is a metabolic pathway that takes place in the cytoplasm of cells and…

Q: The ribosome is the target for many important antibiotics. Distinct antibiotics inhibit various…

A: Introduction  Translation is the process by which the genetic information encoded in messenger RNA…

Q: is a polymer of glucose used for energy storage O Triglyceride O Cellulose O Hexose Chitin O…

A: Polymers are defined as substances or molecules that are composed of repeating units of one or more…

Q: Pseudomonas aeruginosa Log (CFU/ml) 3.9 3.9 4.2 4.5 Time (hr) 0 15 30 45 60 75 90 105 120 135 150…

A: The above question pertains to the calculation of generation time and growth rates of two bacterial…

Q: What environmental constraint favors CAM plants? Select one: a. water availability b. sunlight c.…

A: CAM (Crassulacean Acid Metabolism) plants are a type of plant adapted to arid environments with…

Q: Tryptophan tyrosine and phenylalanine are examples of amino acids? Which type of wound healing is…

A: Amino acids are the building blocks of proteins. There are 20 different types of amino acids that…

Q: Renal failure will almost always result in the development of bone disorders. Briefly describe the…

A: Introduction :  Renal Osteodystrophy is the term used to describe the overall skeleton abnormalities…

Q: 3. Zidovudine (AZT) is a drug used to treat patients with AIDS. AZT works by blocking the reverse…

A: Zidovudine  It is also known as AZT i.e. Azidothymidine. It is an antiretroviral medication used to…

Q: 1. Plants sense drought through the decrease in water potential in the ground. This graph shows…

A: Plants are members of the kingdom Plantae. They are multicellular eukaryotes and are capable of…

Q: what is acetylcholinesterase and where is it found?

A: Acetylcholinesterase (AChE) is an enzyme that plays a key role in relaying signals between nerve…

Q: A fabric company wants to create a new material based on cell research for the army that is able to…

A: Introduction :  The cytoskeleton is the system of fibres that makes up eukaryotic, prokaryotic, and…

Q: In which of the following membrane lipids is the hydrophobic tail connected to the hydrophilic head…

A: Membrane lipids are a diverse group of molecules that are essential components of cell membranes in…

Q: Which of the following is(are) correct about the property of water? ► O Water dissolves foods…

A: INTRODUCTION Water is a molecule made of two hydrogen atoms bonded to an oxygen atom. It is one of…

Q: Make a list of all the common foods you eat that contain trans fats. Looking ahead, develop a plan…

A: Introduction  Trans fats are a type of unsaturated fat that are typically found in processed foods…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: How would a decrease in temperature affect your metabolic rate, What does this occur?

A: Metabolism refers to the chemical processes that occur within living organisms to maintain life. It…

Q: For an autoimmune disease to occur, lymphocytes do not learn how to recognize foreign pathogens as…

A: The immune system of the body is responsible in providing the strength to the body to fight as well…

Q: The function of Nutrient artery

A: Introduction  Nutrition is the process by which the body obtains and utilizes nutrients from food in…

Q: Which of the following statements about metabolic heat is true? A. All animals produce metabolic…

A: Metabolic heat is the heat produced by an organism's cells as a byproduct of cellular respiration.…

Q: A class of students mated fruit flies to study the inheritance of traits. The crosses and their…

A: Introduction :  A single cell divides twice to form four cells during the meiosis process. The…

Evolutionary adaptations

Evolutionary adaptation is the process through which organisms adapt or adjust to their surroundings to increase the chances of survival, mating, and reproduction. An organism's behavior, physiology, and structure are adjusted or changed to make it more suited to its environment.