Q: How do mRNA levels correspond with phenotypes?.
A: * phenotype means the observable physical trait of an organism like appearance and development and…
Q: A few proteins are naturally fluorescent, what physical and chemical factors of the proteins allow…
A: Fluorescent proteins have been appreciated in the field of biology because of their contribution in…
Q: d) draw a chart of the fat metabolic pathway in adipocytes and explain how the hormone stimulates…
A: Adipocytes are the fat-storing cells also known as lipocytes. Mesenchymal stem cells give rise to…
Q: Delayed type Hypersensitivity Reaction in which the reaction is slower in onset and develops within…
A:
Q: Why is the ketogenic diet, and even other low-carb diets, helpful for so many different chronic…
A: * ketogenic diet means high fat and moderate protein and low carbohydrate eating pattern that is…
Q: 1. Substances move through biological membranes against concentration gradients via: a. Simple…
A: In active transport, the cell need to use energy in the form of ATP to transfer molecules across a…
Q: Mercury (Hg) is present in trace amounts in coal, ranging from 50.0 to 200.0 ppb. A typical power…
A: A typical power plant burns 1.49 million tons of coal each year . The first calculation if for…
Q: The describes the situation where the gene pool of a population is determined by the genetics of a…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Please answer and explain. Provide references if possible: TOPIC: PARASITES: SCOTCH TAPE SWAB…
A: Please follow step 2 for detailed explanations.
Q: You are studying a biochemical pathway and isolate Neurospora mutants I, II, and III. Mutant I can…
A: According to all the information given above, A will be considered as the starting point of the…
Q: drug that has been screened in cancer model through the generation of induced pluripotent stem…
A: induced pluripotent stem cells are the type of stem cells that are produced from the somatic cells…
Q: Explain how the molecular mechanism of DNA polymerase enhances DNA replication.
A: Introduction - The replication of a double-stranded DNA molecule produces two identical DNA…
Q: How do body structures and functions of a flatworm compare with those of a cnidarian for a. sensory…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: 6. With the presence of fast-food chains, many pcople have the opportunity to «have a quick bite»…
A: Carbohydrate catabolism is the process by which carbohydrates are broken down to provide energy in…
Q: DNA molecule is A. Acidic B. Basic
A: I didn't get I have to do just 9th or all As you didn't mention But you separately posted 9th…
Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…
Q: 24. Chromosomes are also known to contain protein A. True B. False
A: Each cell in our body contains chromosomes. In the human body, there are 23 pairs of chromosomes in…
Q: It is customary to differentiate male and female genders in terms of typical features that include…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: Which came first, the chicken or the egg?
A: Eggs certainly came before chickens eggs as the shelled orbs laid by birds from which their chicks…
Q: Spurred by record breaking heat waves and drought in the United States, how did views on climate…
A: Introduction - Climate change is a long-term shift in the average weather patterns that have come to…
Q: Describe the features of genes with five (5) statements
A: The term gene was coined by Wilhelm johannsen who banish botanist.Gene is word come from the Greek…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: Carbohydrate catabolism is a process of breakdown of carbohydrates to provide energy in the form of…
Q: What are the specific genetic tests used for Beta-Thalassemia?
A: Beta-thalassemia is a condition that can be inherited from one or both parents. It is a blood…
Q: what suggestion do you have pertaining to the management of the diseases: a-KG dehydrogenase,…
A: Enzymes are essential components of all metabolic processes in the body. They are catalytic…
Q: What key features are required for an expression vector that would allow expression of a therapeutic…
A: In molecular biology, expression vector is a plasmid/viral vector for the expression of any…
Q: Which part of a cell allows nutrients and other material to enter or leave the cell ?
A:
Q: 4. During a lunch at a McDonald's outlet, an office employce received about 350 g of carbohydrates…
A: In the liver, the basic process of carbohydrate and lipid metabolism are: Carbohydrate metabolism:…
Q: The Simian Immunodeficiency Virus (SIV), is an HIV-like virus that originally attacks the immune…
A: Some Important features of SIV (source :- Wikipedia ) Simian immunodeficiency virus (SIV) is a…
Q: Why do K-selected species tends to be successful in a climax community? Why?
A: K selected species are the one based on k and r theory. This theory states that the the trait…
Q: The Citric Acid Cycle takes the molecule of acetyl CoA and generates ________ per glucose molecule.…
A: Citric acid cycle, also called as Krebs cycle, was first described by H.A. Krebs. The citric acid…
Q: All of the following are functions of connective tissues, except energy and mineral storage.…
A: Introduction Tissue is a collection of cells with similar structures that work together as a unit.…
Q: Charles Darwin had so many observations after his voyage through the HMS beagle. What Darwinian…
A: Charles Robert Darwin, English naturalist, was the first to founded the theory of organic evolution.…
Q: 1. The alternate form of a gene is A. Alternate type B. Recessive character C Dominant character D.…
A: Introduction A gene is the basic physical and functional unit of heredity, these are passed from…
Q: PLEASE MAKE SURE THE STATEMENT IS TRUE OR FALSE A) Regarding hereditary elliptocytosis (HE): A. It…
A: Hereditary elliptocytosis is a condition where the RBCs are irregularly shaped and this disorder is…
Q: Charles Darwin had so many observations after his voyage through the HMS beagle. What Darwinian…
A: The Galapagos archipelago is dominated by these finches. The finches living in Galapagos islands…
Q: What type of DNA changes are there for c.316-106C>G mutation. Is it pathogenic?
A: This is showing a type of mutation in which cytosine has been converted into guanine. Cytosine is a…
Q: The Yukon Hospital First Nations Health Program O does not provide biomedical care. O used the…
A: Yukon Hospital First Nations Health Program It works with Non-Insured Health Benefits (NIHB). It…
Q: 1. Explain why protein should be included in the diet?
A: Protein which is basically made up of amino acid chains are important part of our overall diet. All…
Q: 1. How does the human body regulates body temperature? 2. Use Le Chatelier's principle and reaction…
A: Introduction Sweat glands present in skin help dissipate the heat during summers by evaporation of…
Q: Which of the following concepts is one of the fundamental bases to determine that organisms such as…
A: The evolution of species and relation between different organisms can be identified by the…
Q: The way an individual's energy is divided among growth, maintenance, and reproduction is controlled…
A: Answer :- Option (B) is correct. - Individual survival.
Q: How could you use the diversity of metabolic pathways that produce the same or similar products to…
A: Answer:- Steps from first to last as, 1 .A pathway exists and accomplishes some function. 2. An…
Q: suggest a strategy that you might employ to isolate all of the genes involved in nitrogen fixation…
A: Nitrogen fixation is the process by which the free form of atmospheric nitrogen is converted or…
Q: . It's possible that a bone tumor will not show up on an x-ray ) image but will show up in a gamma…
A: Cancer is the leading cause of death worldwide, according to the World Health Organization (WHO).…
Q: The impact of green technologies to the world.
A: Introduction The application of one or more of environmental science, green chemistry, environmental…
Q: WHat is Bioprospecting? Describe challenges/issues that Bioprospecting has?
A: Bioprospecting is the definition that they are about to describe through the study of the diversity…
Q: smallest unit of genetic material which produces a phenotypic effect on mutation is
A: NOTE:“Since you have asked multiple question, we will solve the first question for you. If you want…
Q: Please select a disease (like cancer) that can be modeled through the generation of induced…
A: * Induced pluripotent stem cells are usually will produce insulin and CRISPR which is used to…
Q: Sod 1 mutation 4. A description of how mutation of the orthologous protein in humans has on the…
A: The SOD1 gene controls the production of a superoxide dismutase enzyme, which is abundant in all…
Q: safety measures must be observed in handling the Harada-Mori Culture Technique preparation
A: NOTE: As per our company's honor code, mentioning external references are not allowed. Thank you!…
Explain briefly what are the possible mutation that occurs during the central dogma process?
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Which step of the Central Dogma is responsible for transmission of genetic information from generation to generation? Explain.The following is a list of mutational changes. For each of the specific mutations described, indicate which of the following terms could apply, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair 2. an A-T base pair is changed to a T-A pair a. transition b. base substitution c. transversion 3. the sequence AAGCTTATCG is changed to d. inversion AAGCTATCG c. translocation f. deletion 4. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. insertion 5. the sequence AACGTTATCG is changed to AATGTTATCG h. decamination 6. the sequence AACGTCACACACACATCG is i. X-ray irradiation changed to AACGTCACATCG j. intercalator 7. the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where foxl and fox2 are highly homologous, recently diverged genes) to bog-rad-fox1-fox3- fox2-try-duf (where fox3 is a new gene…The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
- Describe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATASilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?Name three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a gene
- The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)Define FOUR (4) types of point mutations within coding sequencesTwo types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)