Q: Epigenetic modification of gene expressiona. always inhibits gene transcription.b. always stimulates…
A: Epigenetics involves the alteration of a phenotype that is heritable in nature without any effect on…
Q: a way in which proto-oncogenes can change to become genes that induce cancer?
A: A proto-oncogene is a normal gene that can turn into an oncogene due to mutations or increased…
Q: A researcher found that she could increase phosphorylation of amino acids adjacent to methylated…
A: Histone Phosphorylation It is associated with transcriptional activation. It takes place with the…
Q: Translational control of gene expression occurs within thea. nucleus.b. cytoplasm.c. nucleolus.d.…
A: A gene is the fundamental biology unit just like the atom. Gene expression is the process by which…
Q: Explain how DNA methylation and the formation of a DNA loop control the expression of the Igf2 gene…
A: ANSWER - Before giving the answer there are few words which we have to understand .…
Q: The rb gene encodes a protein that inhibits E2F, a transcriptionfactor that activates several genes…
A: Abnormal and unnecessary growth of cells termed cancer. Mutations in DNA causes cancer. In the…
Q: Which of the following types of epigenetic changes may promote cancer?a. DNA methylationb. Covalent…
A: Epigenetics represents one of the merging fields of biology concerned with the study of heritable…
Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…
A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…
Q: Which of the following gene expression regulatory mechanisms saves the most energy but takes the…
A: Gene expression can be described as a process by which the genetic information stored in the gene is…
Q: Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are…
A: The antisense RNA, transcriptional repressor proteins, and feedback inhibition are different…
Q: The key to epigenetic regulation is ________. a. controlling accessibility to transcription…
A: Epigenetic regulation of a gene is the interaction by which the activity of a specific quality is…
Q: What would the direct consequence to a cell be if there was a loss of function of Transcription…
A: Transcription is the process in which the DNA is transcribed into an mRNA. There are three basic…
Q: Several new cancer drugs inhibit the enzymes that either put acetyl groups on histones or take them…
A: Cancer in simple term can be referred to a set of diseases which are caused by the production of an…
Q: Epigenetics works by Select one: a. activating DNA ligases so they can clip attached methyl groups…
A: Epigenetics is a field of study within genetics that focuses on heritable changes in gene expression…
Q: Which statement(s) below regarding DNA mutations is true: A. Mutations only occur in genes B.…
A: Ans: D) Mutation can occur in promoters. Mutation is a change in the sequence of DNA due to…
Q: Why is regulating transcription the main way that cells control gene expression? A. Because…
A: Transcription is the process in which RNA is synthesized with the help of RNA polymerase enzyme. RNA…
Q: Harry Potter speaks parseltongue(he can talk to snakes). Dumbledore explains that this is because…
A: Language is an example of a trait that is learned and developed throughout a lifetime. Language is a…
Q: Which of the following could represent an epigenetic modification in a cell? A. Deletion of…
A: Epigenetic changes are modifications to DNA that regulate whether genes are turned on or off. These…
Q: Which of the following is not an example of epigenetic gene regulation?a. genomic imprinting in…
A: Which of the following is not an example of epigenetic gene regulation?
Q: Epigenetic marks regulate gene expression. Which epigenetic mark is NOT associated with positive…
A: These are chemical modifications that change the gene expression, make it on or off
Q: 1. The following image shows a mechanism in which gene expression activity is regulated by ligand.…
A: In prokaryotes, the synthesis of the gene's transcript and its encoded protein product is termed…
Q: Which of the following are examples of molecular changes thatcan have an epigenetic effect on gene…
A: Epigenetic effects are such changes that bring about changes in the phenotypic expression of a gene…
Q: Which of the following is true of CpG islands? a. They are methylated near promoters of actively…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains. It coils around each…
Q: Go to the PubMed website and search the words epigenetic and cancer.Scan through the journal…
A: Ans: Epigenetics: It is the study of heritable changes in expression of genes without changing the…
Q: Gene expression regulation by methylation of the cytosines in a promoter would be considered
A: Answer - Option B - Transcriptional regulation
Q: once transcription is complete gene expression is controlled by..........?!
A: In eukaryotic cells, after the transcription, the RNA needs to be modified or Processed into a finer…
Q: Is each of the following statements true or false? A. An enhancer is a type of regulatory element.…
A: Gene is a section of DNA with information to construct a protein. Gene is actually made from a…
Q: Distant regulatory sites are called
A: During gene transcription some regulatory genes are attached to the transcription site which…
Q: Which of the following does not accurately describe eukaryotic transcriptional factors? a. Changes…
A: Introduction Transcription factors are the proteins that specifically are involved in the…
Q: A mutation in the p53 gene creates a misfolded protein that is overactive. This scenario would most…
A: Tumor suppressor gene P53 activity stops formation of tumors. This gene makes protein that is…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: researcher has identified a mutant strain of yeast whose histones are unable to be acetylated. Which…
A: Histone acetylation and deacetylation are the processes by which the lysine residues within the…
Q: DNA methylation prevents gene expression. Methylation and de-methylation are stimulated by a…
A: Methylation Methylation is metabolic process takes place on the DNA. The methylation of DNA control…
Q: DNA methylation is A. heritable and generally activates gene expression. B. heritable and…
A: The gene expression is the production of mRNA from the DNA that is known as transcription. This…
Q: Which of the following statements about methylation and acetylation is correct? A. Genes that have…
A: Introduction Deacetylation is the removal of an acetyl group and occurs on a plethora of targets and…
Q: Which of the following is NOT a description of an epigenetic modification? A. regulatory patterns…
A: Changes in gene expression that are not produced by changes in DNA sequences but are caused by…
Q: Eukaryotic cells have multiple complex mechanisms for the regulation of gene expression, but a…
A: Answer :- a) Operons Explanation - Eukaryotic genes aren't organized into operons, therefore every…
Q: Which of the following statements concerning p53 is NOT correct? O a. O b. O C. p53-dependent…
A: p53 is a gene that helps to control the cell cycle and prevent cells from becoming cancerous. It…
Q: The following type of mutation in a proto-oncogene may cause cancer in human: A. Translocation of…
A: Cancer is a condition in which some cells in the body develop uncontrollably and spread to other…
Q: You are analyzing the activity of the protein p53 in two different cell types. You notice that p53…
A: The function of a protein is primarily related to its structure if the composition of protein is…
Epigenetic control of gene expression
a. is hereditary. c. adds methyl groups to cytosine.
b. locks genes “ON.” d. Two of these
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Epigenetic modification of gene expressiona. always inhibits gene transcription.b. always stimulates gene expression.c. is erased from the DNA following mitotic cell division.d. may sometimes be transmitted from generation to generation.Translational control of gene expression occurs within thea. nucleus.b. cytoplasm.c. nucleolus.d. mitochondria.Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional level b. epigenetic and transcriptional levels c. epigenetic, transcriptional, and translational levels d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels
- In one cell, gene C is expressed, whereas in another cell, geneC is inactive. After the cells are fused experimentally, both copiesof gene C are expressed. This observation could be explained bya. a cis-epigenetic mechanism.b. a trans-epigenetic mechanism.c. DNA methylation.d. both a and b.Epigenesis relating to genetics refers to which of the following A. Genetic information is limited to what we inherit only from our biological parents. B. Genes are not influenced by environmental factors. C. Genes we inherit are fully expressed at birth. D. Genes are turned on or off as needed, by the developing body or environmental triggers, across the life-spanWhich of the following is NOT a mechanism of control of gene expression Group of answer choices a. Co-dominance b. mRNA transport c. DNA Methylation d. Control of translation e. Control of transcription
- Which of the following are examples of molecular changes thatcan have an epigenetic effect on gene expression?a. Chromatin remodelingb. Covalent histone modificationc. Localization of histone variantsd. DNA methylatione. Feedback loopsf. All of the aboveWhich of the following is NOT a description of an epigenetic modification? A. regulatory patterns that persisis in the absence of the original signal B. stable alterations in gene expression without changes to the underlying DNA sequence C. the persistence of gene expression patterns through cell division D. an intrinsic signal that triggers cell differentiationEpigenetic changes in gene regulation are caused by _ _ _ _ _ _ _ a. missing nucleotides or chromosomes b. modifications to histones and the DNA, but not the nucleotide sequence itself c. mutations of the nucleotide sequence
- How does reverse methylation affect gene expression? Select one: o a. The gene is turned off, but still expresses a protein product. b. The gene becomes transcriptionally silent. c. There is no effect on the gene. d. The gene is hyperactive resulting in a gain of function. e. The gene expresses the wrong protein. Clear my choice How do microRNAs regulate epigenetic mechanisms during development? Select one: o a. MicroRNAs function as gene repressors b. You only find microRNAS in epigenetic and cancer cells c. MicroRNAs function as gene activators d. MicroRNAS regulate methylation on the DNA sequences of embryos e. Researchers find that when microRNAs are present the effects of epigenetic modifications are 50% greater Clear my choiceEpigenetics works by Select one: a. activating DNA ligases so they can clip attached methyl groups off. O b. activating DNA polymerases so thymine is more readily attached to the lead gene. c. blocking the cell's ability to read certain genes. O d. blocking the cell's ability to undergo cytokinesis.Which of the following is true of CpG islands? a. They are methylated near promoters of actively transcribed genes. b. They are unmethylated near promoters of actively transcribed genes. c. Acetylation of CpG islands leads to repression of transcription. d. CpG islands code for RNA molecules that activate transcription.
![Concepts of Biology](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)
![Concepts of Biology](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)