Each set consist of five key players in the process involved in the central dogma. Choose ONLY two items that perform same fuction
Q: MRNA HRNA Topoisomerase DNA gyrase Sense strand Bubble Promoter region Antisense strand Coding…
A: Central dogma means the flow of genetic information in the cell. It states that the 3 main process…
Q: What do the researchers think this study contributes to What are its limitations?
A: The provided text presents a case report investigating the feasibility and effectiveness of…
Q: 2. The nucleic acid of a bacteriophage enters the cell through; a. Injection b. Fusion c.…
A: Bacteriophage Bacteriophages are viruses that can infect and destroy bacteria. Obligate…
Q: The dual faces of life is unity and Answer:
A: Life may be described as the life of a living being as well as the coexistence of all living beings…
Q: How is the central dogma critical to the proper functioning of an organism?
A: Hi, Thanks For Your Question. Answer : "The Process Of Converting DNA Instructions Into A…
Q: In comparing the bird circulatory system to the mammal circulatory system, the bird system has O All…
A: All the choices are correct.
Q: why and how there are cases where beneficence and justice overlap?
A: INTRODUCTION- Health is a state of physical, mental, social, emotional and spiritual well being. To…
Q: Based on the evolutionary relationships among the chimpanzees, humans, gorillas, orangutans, and…
A: The examination of evolutionary relationships between biological things — usually species,…
Q: 3. Loss of secretions from the nasal and pa lesion of which of the following nerves? O…
A: Cranial nerves arise directly from the brain and there are 12 pairs of cranial nerves (CN I to CN…
Q: what are the three most compelling reasons that would support legalizing euthanasia?
A: The deliberate ending of life to relieve pain and suffering is known as euthanasia. There are…
Q: TSA PLATES: SPECIFIC AREA ISO CLASS CFU BSC O cfu/m Buffer area 7 7 cfu/m Ante-area 8. 102 cfu/m
A: Colony Forming Unit ( CFU ) -- Introduction -- In the microscopic study ,while studying all dead…
Q: 5. Consider the thermodynamics of DNA replication. What are the different thermodynamic parameters…
A: Central dogma states that the flow of information is unidirectional and irreversible, i.e.…
Q: 7 Pribnow box Sigma factor Hogness box Aminoacyl tRNA synthase Rho factor 8 DNA pol 5 hnRNA RNA pol…
A: Central dogma explains the flow of genetic information in all cells. The three main processes:…
Q: What is the main idea of pseudoreplication in a manipulative experiment? Give an example problem of…
A: Pseudoreplication is described as using inferential statistics to check for treatment effects with…
Q: What is individual eugenics and why do some people think it is not true eugenics?
A:
Q: Why death is a return?
A: Death : 3 types Clinical death: when the heart stop beating Brain death: absence of brain activity…
Q: Choose which rule is violated by the following definition. A veterinarian is a doctor specializing…
A: The veterinarian takes care of the animals.
Q: In your own words, explain the following concepts and provide at least one example for each:…
A: Non-concordance in biology refers to the lack of agreement or consistency between two or more sets…
Q: You are called to a hospital emergency department to investigate the death of an infant who was…
A: 1) you should know about the time the child was found unconscious, the time taken to reach hospital…
Q: Split DNA (old strand) Split DNA (old strand) T New DNA New DNA strand strand A T A А A C C G A T A…
A: There are five nucleic bases—adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U),…
Q: What processes are regulated and controlled or affected by the central dogma and why must these…
A: The term central dogma is associated with explaining several processes occurring in the human body…
Q: What is set-point theory?
A: Set-point theory- According to set point theory, the human body tries to stay within a certain…
Q: Which structures are highlighted? O ducts O tollicies Opancreatic isicts O pituicytes Oacini
A: The pancreas is both exocrine as well as an endocrine gland. The exocrine gland secretes the enzymes…
Q: The relative age effect in youth sports: A. Is shown in a season of birth distribution bias B. Is…
A: Knowing about the relative age impact is crucial so that we may take action to lessen its effects…
Q: What is the name of the nucleoside (the base and sugar complex) shown? NH HO-CH; H OH. H OH O…
A: Nucleoside These are the structural subunit of nucleic acid such as DNA and RNA. Nucleoside is…
Q: Is it always good to accept a valid deductive argument? Please explain your answer with an example.
A: A valid deductive argument is a statement that should not be necessarily true to be considered as…
Q: What is the difference between the Oregon Death with Dignity Act and Euthanasia?
A: The death is a normal process in life which will occur at any time once the person is born in the…
Q: O ATP pyruvate O acetyl-CoA охуgen hydrogen ions
A: The mitochondrial inner membrane is made primarily of a phospholipid bilayer, just like the cell…
Q: how is the correct order to arrange the steps
A: Step1 position the unit away from heaters and atleast 12 inches away from wall. Step 2 Locate the…
Q: Which of the following statements are correct? Multiple choices can be correct.
A: The given statements are evaluated and explained which are correct and which are incorrect in step…
Q: The following is an excerpt from a discussion of Principlism, which we have studied.…
A: A nurse or a healthcare professional's main objective lies in providing the best care to the…
Q: hich of the explanations provided in the cartoon (A, B, C, or D) is more accurate and why? What is…
A: The image is of a cartoon, showing a girl who is hurt and she got a cut on her skin of the knee. She…
Q: The most abundant polysaccharide in the biosphere is
A: Polysaccharide are made up of repeating units of monosaccharides. Amylose is a linear polysaccharide…
Each set consist of five key players in the process involved in the central dogma. Choose ONLY two items that perform same fuction.
Step by step
Solved in 4 steps
- Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…Historial Marcadores Ventana Ayuda 0 Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA polymerase DNA 5' 3' P つつつ 3' 5' RNA transcription A (4444 O carrollcc.instructure.com Edit View Insert Format Tools Table OO Hairpin loop (GC-rich) บบบบบบ 3′ RNA O е 12pt ✓ Paragraph | BIUA 2 T²V | V (LD) 5' ♫ tv A A Ċ 1 pts C T AEcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
- 40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
- E D ot OH ON O Replication R SORO Transcription ORNA processing Translation Gene expression 657 F Q Search % T G LOCLE Y F7 & 87 F8 U 99+ 8 F9 53879 10 F10 O 2 H J K L CV BN MO < F12Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase DNA Polymerase O RNA Polymerase 9MD