Q: TRUE OR FALSE 1. A mutation is considered induced when a bacterial cell is exposed to harsh environ...
A: All the given statements are true.
Q: Explain the effect of linkage and recombination on gamete genotype
A: Linkage occurs when genes located on the same chromosome remain linked together in passing from one ...
Q: Explain what makes Thomas Hunt Morgan an interdisciplinary thinker with his Fruit fly discovery
A: Morgan chose the fruit fly, Drosophila melanogaster, for his genetic studies. fruit flies may lack i...
Q: Stickleback fish that are deep in the ocean can experience a mutation wherein they experience a "los...
A: Introduction: Homozygous refers to a particular gene that has identical alleles on both homologous c...
Q: How many strutures are found in an animal call
A: Animal cells can range in size from a few millimetres to a few centimetres. The ostrich egg is the l...
Q: What is the purpose of the Kreb's Bicycle in nitrogen metabolism? Include in your description where ...
A: Introduction: The reactions which help in converting pyruvic acid to carbon dioxide and water in mit...
Q: Functional Group Name Structural Diagram (draw all bonds) Found where in the body??? Hydroxyl H -N H...
A: Functional groups can be described as the groups of molecules that get linked to organic molecules a...
Q: identify some common problems involving the digestive, digestive, respiratory and circulatory system...
A: Common problems in digestive system : Disorders of digestive tract or gastrointestinal tract are kn...
Q: Molecule #T ajvvnat up? (Cal Lipiu, Acid). b)Within the group, how would you classify it? CH̟OH a) H...
A: First molecule shown is a monosaccharide. Different or same monosaccharides join via glycosidic link...
Q: In a short personal essay, what is the ultimate purpose of human life
A:
Q: How Small Noncoding RNAs Play Regulatory Roles in Bacteria ?
A: Small RNAs (sRNAs) influence gene expression via base pairing with mRNA after transcription. The int...
Q: Why do we need to be aware of cultural differences and be culturally appropriate?
A: The integrated and maintained system of socially acquired values, beliefs, and standards of conduct ...
Q: How is mitochondrial DNA transmitted to children?
A: Q. How is mitochondrial DNA transmitted to children? Answer - mitochondrial DNA makes up 1% of Cellu...
Q: Describe the smaller and largest living unit of Brain
A: Cerebrum is the largest part of brain however neurone is the smallest unit of brain
Q: Which bulb shaped structures found at the end of neurons form connections with the dendrites and som...
A: Introduction :- A neuron is a nerve cell that serves as the foundation of the nervous system. In man...
Q: As a historical thinker wondering about cause and consequence, ask yourself questions such as these:...
A: The world war 1 which lasting from August 1914 to November 1918, had a huge effect on Canada. In th...
Q: Please answer fast If the plasmid Lac operon has a mutated lacO operator gene that prevents the rep...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: the effects of a single allele (A2) on fitness in two populations of the same plant species, Populat...
A: The average excess of fitness is a measure of the fitness of a particular allele (Say aA2). It can b...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Pancreatic juices, saliva, and bile are used only for mechanical digestion? A. True B. False
A: Mechanical digestion comprises physically breaking down food items into smaller chunks in order for ...
Q: environment
A: Insects adaptations include mouth parts, the ability to fly,leg types and body shapes... They die, t...
Q: QUESTION 4 Which of the following is required for activation of the adaptive immune system" O Activa...
A: Adaptive immune response is generated when innate immune system cannot eliminate the pathogens.
Q: When light hits the center of an ON-center receptive field, which of the following processes occur: ...
A: The following facts are required to be known to answer this question with logic:- Suppose there is ...
Q: Heart beat activity
A: Heart normally beats in a regular rhythm.For an adult,the normal heart beat is 60-100 per minute.Hea...
Q: Which child is female 3 most likely an aunt of? O 1 O 2 3 4
A: DNA fingerprinting is a technology used to determine paternity, genetic relationships, and to solve ...
Q: What advantages are there to having genes arranged in an operon, compared with the arrangement in eu...
A: The gene is the basic morphological and physiological unit of heredity. DNA is used to make genes. S...
Q: What time of mutation is exhibited when a codon AAT is replaced with GGC? a. Insertion b. De...
A: 1) Option C that is Substitution is the correct answer because in substitution, replacement of one o...
Q: . What is the main difference between prokaryotic and eukaryotic cells?
A: There are two types of cells eukaryotic cells and prokaryotic cells, the cells differ in their cellu...
Q: To map the location of a tumor in the brain, a neuropsychologist uses a/an ______, which creates a t...
A: Introduction: When cells grow and divide more than they should or do not die when they should, an ab...
Q: 28. Given the relative proportion of DNA that directly codes for genes, is it reasonable to say that...
A: Introduction :- A gene is a basic unit of heredity in biology, consisting of a sequence of nucleotid...
Q: How many bones in the human body
A: Bones provide structural support and rigidity to different organs of the body. They form attachment ...
Q: Trace the path of a sperm cell from the site of its maturation to the site where it leaves the male ...
A: Seminiferous tubules inside the testis are the site for sperm production. the produced sperms are th...
Q: What insects are expected to have the most sclerotized heads? Explain.
A: Sclerotization is a biological process in which part of a tissue / whole tissues stiffen and become ...
Q: (A) Explain clearly the developmental and evolutionary significance of the neural crest within the p...
A: Neural crest: it is found in vertebrates. Neural crest cells are derived from ectodermal layer of th...
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence. T...
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding r...
Q: The ratio of male-to female age-adjusted mortality rates in the United States for pneumonia and infl...
A: Age Adjusted Mortality Rate: The AGE-ADJUSTED DEATH RATE is a death rate that accounts for populati...
Q: How is a protein with a proper sequence generated?
A: Amino acids are biomolecules made up of two functional groups: an amino group (-NH2) and a carboxyl ...
Q: QUESTION 4 A person with agammaglobulinemia: cannot produce antibodies cannot produce interferons do...
A: Agammaglobulinemia is a inherited disorder in which, person has low levels of protective immune syst...
Q: Aerobic Respiration Chart Aerobic Respiration Location (Euk/Pro) ATP ATP used produced Type of produ...
A: Aerobic respiration is a process of cellular respiration takes place in the presence of oxygen to pr...
Q: How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside tr...
A:
Q: The _ is the region that triggers hunger in response to signals from nerve cells and messages carrie...
A: Hypothalamus Its forms the lower or ventral part of diencephalon. It lies at the base part thalamus...
Q: Question:- Describe control strains used in the clinical microbiology laboratory and explain their ...
A: Standard strains (quality control strains) are microorganisms with well-defined susceptibility or re...
Q: distinguish domain Eukarya from the 2 prokaryotic domains (Bacteria and Archea). Describe and compar...
A: * the three domain system proposed by Carl worse. * It includes bacteria,archae and eukaryota.
Q: If a patient was bitten by a poisonous spider (black widow) and the effects of its venom occurred at...
A: The neurons are the smallest units of the nervous system. they are the nerve cells that are involved...
Q: What is adaptive immunity ?
A: Immunity is a complicated biological system with the ability to recognise and tolerate what belongs ...
Q: 1b. If the undertermination thesis is false, then scientific theories can be deduced from observatio...
A: Undetermination thesis It is a thesis that states that for each scientifically established hypothesi...
Q: What is the advantages if using Kato-Katz method?
A: Kato-Katz method is a widely adopted method to prepare human stools for examination of the presence ...
Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...
A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...
Q: Using a Venn diagram differentiate muscular strength from muscular endurance.
A: Muscular Strength:- The amount of force that a muscle can produce in one single contraction. Muscula...
During a flame test, why is it necessary to use a new splint for each element?
A splint is a thin wood/stick used commonly in laboratory for performing a flame test. The splint is kept close to the opening of the tube containing the chemical mixture and gas is released from the tube onto the stick. The flammable gas will ignite the stick
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Why is it necessary to cut thin sections of the tissue sample from a specimen using a microtome?Looking at the streak plate below, is it good or poor technique (it may look slightly different because it is done by a left handed person....LOOK AT THE TECHNIQUE), explain your answerWhat two sources of creatinine are needed to conduct a Creatinine Clearance test?
- Can you explain the idea a little more? I don't fully understand how to do something. Do we need to add a new drug? Should I change the printing method of the surgical patch? How will the idea develop?The high viscosity chracteristic of normal synovial fluid samples is caused by: 1) Hyaluronic acid 2) Hyaluronidase 3) Elevated white blood cell counts 4) The presence of crystalsWhat pathogenic agent undergoes the Sigmoidoscopy Material procedure?