double helices Question #15: Which of the following forms of carbohydrates are related by purely conformational change? A) Glycosidic bonds in branched vs. unbranched polysaccharides ? OB) Alpha vs. beta anomers x C) Two different chair forms of pyranose rings VDL vs. D monosaccharides VE)Different epimers of a monosaccharide Question #16: Which of the following is true about polynucleotides? A) All of these answers are correct B) Their sequences are written in the 5 to 3' direction v C) Cations non-covalently bind to polynucleotides to counteract the negative charge of the phosphates in the backbone v D) Phosphodiester linkages join individual nucleotides E) In a double helix, the two polynucleotide strands are oriented in opposite directions Question #17: The Michaelis constant Km is equal to the dissociation constant Kd under what circumstances? A) The rate constant for the chemical step of enzyme catalysis is very slow. relative to association and dissociation of the enzyme:substrate complex 3) The concentration of substrate is equal to the concentration of enzyme None of these answers is correct kcat is greater than Km

Q: QUESTION 9 Prosthetic groups in the class of conjugated proteins known as glycoprotein are composed…

A: Conjugate protein has protein component as well as non-protein component joined together either by…

Q: Question 2B please.

A: Agglutination is the clumping of the red blood cells with the respective antibodies added to the…

Q: Question #14

A: Cell cycle is the sequential steps that divides the cell into two or more daughter cells. The four…

Q: 3. Counting Barr Bodies How many Barr Bodies would be present in cells of individuals with the…

A: Barr bodies are X chromosomes that are inactive in female mammalian cells. Barr bodies are named…

Q: 5. If the hypothetical restriction endonuclease CutVI were to recognize and cleave a circular piece…

A: A restriction endonuclease is an enzyme that recognize specific sequence present on DNA and cleaves…

Q: 2. It has historically been argued that competition drives evolution. However, some believe that…

A: Thank you for the question Answer : In modern times it is believed that collaboration is more…

Q: Most hormones, such as peptide hormones, exert their effects by binding to cell- surface receptors.…

A: Hormones are involved in the signaling molecules which are produced by glands of the multicellular…

Q: dentify the structure highlighted in blue.

A: The brain and the spinal cord are the main organs of the human nervous system. The human nervous…

Q: 2. Is the Mueller-Hinton Agar (MHA) a complex or defined medium? Explain based on its composition.…

A: microorganisms are grown in laboratory using growth media . usually these media are having the…

Q: 6. Brown hair (B) is dominant to blond hair (b). If there are 150 brown haired people in a…

A: 6B. Given that, brown hair (B) is dominant to blond hair (b). This means that a person who is…

Q: Using Table 1 from the lab introduction reading answer the following question: You see a cell that…

A: Cell wall  The non living component, covering the outmost layer of a cell. Its composition varies…

Q: QUESTION 10 1. Which of the following sugars have B (1-4) glycosidic linkages? (1) The hereto…

A: β-1,4 glycosidic bond is formed by formation of  covalent bonding of oxygen to the C1 of one glucose…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: 9-10. Refers to the torso model below. 41

A: It is gastric artery

Q: Identify the primary function(s) of hyaline cartilage. Select all that apply. > View Available…

A: Cartilages- The cartilages are the firm and softer tissue that is more flexible and present…

Q: . How would the rapid accumulation of succinyl-CoA affect the rate of glucose oxidation?

A: Cellular Respiration is the oxidative process through which energy is obtained from the food. The…

Q: question number 5 please

A: Differential centrifugation is a process used to separate various cell organelles and other…

Q: 5c. If not, what additional information would we need to collect to tell whether the yeast used…

A:

Q: Question #3

A: Frequency is the number of the occurrences of a repeating event. In genetics frequency of a trait in…

Q: 9. A researcher measured the absorbance of a sample of C. vulgaris and found it to be 0.05. What is…

A: Ans 9.Beer lambert's law states that there is direct linear relationship between the absorbance and…

Q: 5. A patient cuts 100-mg scored tablets to take his 50-mg prescribed daily dose. A prescription for…

A: According to the guidelines of Bartleby,Since multiple questions are posted the expert can only…

Q: QUESTION 8 Which one of the following is not among the six internationally accepted classes of…

A: Based on the reaction they catalyse enzymes have been categorised into 6 different classes.

Q: Why are the protists in termites obligate endosymbionts? Please select all correct answers. Select…

A: Introduction:- Living organisms interact with each other in different ways like -  mutualism,…

Q: Use the graph below to answer the questions 8 and 9 0.15- 0.10- + C.vulgaris 2714 0.05- + M.…

A: Algae are a wide category of photosynthesis-capable aquatic creatures. Seaweeds (for example…

Q: Adipocytes store fat in phospholipid-coated droplets in the cytosol. The protein perilipin is also…

A: Perilipin, also recognized as a protein associated with lipid droplets, is a protein that is…

Q: Question 50

A: Antimicrobial drugs differ in their mode of action, including inhibition of cell wall, inhibition of…

Q: 4. If a parent cell has diploid number of 14 chromosomes prior to mitosis, how many will each…

A: In the cell duplication process known as mitosis, the parent cell divides into 2 daughter cells…

Q: Extension Questions 14. Other polar molecules include nucleic acids and some proteins. Look at the…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms.…

Q: All of the following are true about grasses except

A: Grasses are angiosperms.

Q: An arctic hare's coat color changes from white to brown each spring in response to a change in its…

A: Climate Change : Climate change refers to long-term shifts in temperatures and weather patterns.…

Q: QUESTION 3 Glutamate dehydrogenase (GD) is an important enzyme of nitrogen metabolism and is…

A: Inhibitors are the compounds that tend to decrease the rate of enzyme catalyzed reaction. They do so…

Q: Question 3 A species of hummingbird feeds on nectar of a particular plant whose flowers form a long,…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: 4. Which of the following immune cells acts as an antigen a) Suppressor T cell b) c) Natural killer…

A: The immune system is a complex set of defense mechanisms present in humans and other advanced…

Q: One can argue that although the existence of retroviruses represents a complication of Crick's…

A: Retroviruses are a type of RNA virus that have a unique replication process involving the conversion…

Q: Answer the above question for CutVI if the starting DNA were linear instead of circular.

A: Restriction enzymes are enzymes that identify specific sequences in DNA and cut DNA at or near these…

Q: 4. One type of beetle found in fields where corn is grown can have either a grey outer shell or a…

A: In the given question- The allele for dominant trait (Grey outer shell) is G The allele for…

Q: The most common corn grown by Native Americans in northern North America was which of the following?…

A: Flour  is a very popular category of corn which is grown  in North America. This variety is…

Q: QUESTION 16 Which statement incorrectly pairs the cell type with its function? Satellite cell -…

A: Neurons are extremely specialized cells that form the core of the nervous system. The nervous system…

Q: What metabolic process may produce lactate (or lactic acid) as an endproduct? Where did you learn…

A: Cellular respiration is a major process in the body that involves three metabolic pathway such as…

Q: 6. What are 3 stimuli that regulate animal cell division?

A: Different signals that enable optimal timing, coordination, and regulation of the process control…

Q: Which of the following combinations describes the most abundant energy storage polysaccharide in…

A: Disaccharides are the simplest and most common oligosaccharides. A disaccharide consists of two…

Q: 6. For each of the following tasks performed in the activity, describe what they are actually…

A: The process of gene transcription in order to generate RNA, the translation of RNA into proteins,…

Q: QUESTION 4 Which length of DNA fragment would move the fastest and farthest during an…

A: Gel electrophoresis is general lab techniques to determine the quality and quantity of DNA/RNA in…

Q: 4. In Wisconsin Fast plants, purple stems (P) are dominant to green stems (p). Plants can also be…

A: Chi square analysis is a statistical test to measure differences between observed and expected data.

Q: All viruses contain genetic material surrounded by a protein shell called a Answer. Answer.…

A: DNA virus: These are the virus whose genetic materials are DNA. They take over the host cell to…

Q: 10. The variable region of an antibody a) Binds to a specific epitope on an antigen. b) Can bind to…

A: Memory cells are a type of immune cell that are involved in the long-term response of the immune…

Q: Which of the following is (are) false for sucrose and trehalose? Both are reducing sugars Both…

A: Sucrose is referred to as a nonreducing sugar because of the odd form of connection between the two…

Q: Choose the correct answer (1 option only). • The arm is hepatic, gastric, thoracic, axillary,…

A: There are several terms regarded as anatomical terms that are used in anatomy to define a structure.…