DNA polymerases are capable of editing and error correction, meaning it is able to edit and correct single base error so that the gene is not affected. However, RNA polymerase has a limited capacity for error correction. Given that a single base error in either replication or transcription can lead to error in protein synthesis, suggest a brief explanation for this difference in the capability of error correction between DNA polymerase and RNA polymerase.

Q: Explain how nucleotide incorporation errors by DNA polymerase can be repaired, and the role of…

A: DNA replication is a crucial process in the cell-division. It maintains the chromosome number inside…

Q: When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a…

A: In molecular science, the control of DNA is central to numerous experiments and innovations,…

Q: Please explain one type of “DNA repair” mechanism (what is it, when is it used, how does it work).

A: The process by which a cell detects and repairs damage to the DNA molecules that encode its genome…

Q: Ribosomal RNA in eukaryotic cells is synthesized by which of the following enzymes (exhibiting no…

A: Transcription is the process of the formation of RNA from the DNA. ( DNA to RNA). It involves the…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: Explain if any mismatched nucleotides in RNA primer becomes substrate for mismatched repair enzyme.

A: Living creatures begin the production of DNA strands with RNA primers. Prior to DNA replication, the…

Q: Discuss the similarities and differences between RNA polymerase and DNA polymerase

A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. Nucleotides are the…

Q: Transcription is thus the final stage of gene expression involves interactions between three types…

A: Transcription is copying down of information from DNA to RNA. The final stage that involves gene…

Q: Describe the basic structural features of DNA-binding proteins that allow them to recognize specific…

A: DNA binding proteins are proteins that have DNA binding domains and thus have a specific or affinity…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between…

A: Introduction: DNA is the type of nucleic acid that is the genetic material of the living body,…

Q: Explain why base excision repair, nucleotide excision repair, and mismatch repair—which all require…

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: In reverse transcriptase polymerase chain reaction (RT-PCR), an analytical method used to amplify…

A: Reverse transcriptase polymerase chain reaction (RT-PCR) is a method used to amplify and sequence…

Q: Describe an experimental approach to determining the processivity of a DNA polymerase (that is, the…

A: The processivity is defined as the degree of the addition of an average number of nucleotides prior…

Q: The binding of the SSB (single-stranded binding) protein with DNA (deoxyribonucleic acid) and still…

A: Only when both strands of DNA are been allows to  separated from one other can state the  DNA in the…

Q: Reverse transcriptase has ribonuclease activity as well as polymerase activity. What is the role of…

A: The biological catalysts that speed up the biochemical reactions are called “enzymes”. They act on…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: List two possible reasons why a mistake during the process of replication is more of a catastrophe…

A: When a DNA (deoxyribonucleic acid) molecule (double-stranded) gets copied into two new similar…

Q: A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive…

A: DNA replication is the process of synthesis of new DNA from the template DNA strand by the enzyme…

Q: "The mechanism does not recruit a homologous region of DNA during repair". Explain this ?

A: Introduction DNA repair is a set of procedures that a cell uses to detect and repair damage to the…

Q: The RNA polymerase is only using one strand of DNA as a template, and only transcribes specific…

A: Introduction: DNA, also known as deoxyribonucleic acid, is the genetic material present in humans…

Q: DNA precursor imbalances are mutagenic. For example, if dGTP accumulates, it can compete with dATP…

A: The increasing concentration of dNTP increases the extension of DNA chain. This it does by extending…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Collisions between DNA polymerase and a slower-moving RNA polymerase using the same template strand…

A: DNA is a double-stranded molecule. During its replication, two-parent strands unwind and each strand…

Q: How can the genetic defect phenylketonuria (PKU), which is caused by mutations in the phenylalanine…

A: Phenylketonuria is a genetic defect that is caused by the deficiency of phenylalanine hydroxylase…

Q: A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive…

A: The conditional mutation is a condition where the wild-type genotype is expressed under certain…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.