Answered: DNA Flagella Pili Escherichia coli a.…

Science

Biology

DNA Flagella Pili Escherichia coli a. What is the name of organism? Blank 1 b. Write the name of the kingdom. Blank 2

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter11: Health Of Aquatic Animals

Section: Chapter Questions

Problem 5KA

See similar textbooks

Related questions

Q: express some basic evolutionary relationships among groups of microorganisms

A: Microorganisms, often known as microbes, are tiny organisms that can be unicellular, multicellular,…

Q: Which scientist first disproved spontaneous generation byshowing that maggots only appear on…

A: Spontaneous generation can be defined as the process in which there is the maturation of the living…

Q: Drawings of the types of spicules , label the species containing each type and the type.

A: Sponges belong to the phylum Porifera and have four different classes that are Demospongiae,…

Q: Write a paragraph comparing the endospores of B. anthracis with those of B. cereus and B. subtilis

A: Bacillus species of bacteria have rod-shaped structure, they usually forms endospore and are either…

Q: What is a trichome?

A: Epidermal tissue system or dermal tissue system is derived from embryonic protoderm. It forms the…

Q: Green Algae are: (Choose two). viruses Sbacteria I prokaryotes eukaryotes able to do photosynthesis…

A: Algae are possessed a well-developed nucleus and other cell organelles are surrounded by the…

Q: I dont understand this practice Biology Question. In order to categorize bacteria, scientists use…

A: Bacteria are microscopic organisms not visible to the naked eye. They are present everywhere, both…

Q: What is the main component of a diatom shell?a. agarb. peptidoglycanc. silicad. calcium carbonatee.…

A: Agar is found in the cell walls of Gelidium and Gracilaria. It is not found in the cell wall of…

Q: Abiogenesisa. refers to the spontaneous generation of organisms from nonliving matter. b. explains…

A: The existence of the planet earth dates back to many billion years ago. However, there was no life…

Q: 5) PARASITIC PROTOZOA: Name Group Euglenozoa Disease Transmission Locomotion flagella T. Gambiense…

Q: why it could be damaging to expose your own normal flora/microbiome to antibiotics.

A: The microbiome consists of all the microorganisms that are normally present in the body.

Q: Which of the following statement(s) or feature(s) apply to Amoeba proteus ? Select 3 correct…

A: Amoebas are present as each nonparasitic and parasitic varieties.

Q: FILL-IN-THE-BLANK. Write the word or two that best completes each statement or answers the question.…

A: the answer are given below:

Q: decribe the method of reproduction used by yeast

A: Budding The most well-known method of vegetative development in yeast is asexual reproduction by…

Q: A. Differentiate the microorganisms by filling in the table with YES or NO. For virus, state if it…

A: Bacteria - Bacteria are unicellular living organisms that are considered prokaryotes (without any…

Q: The image below is a representative of protozoa known as O G. lamblia O E. coli O A. vaginalis C.…

A: Living organisms are classified into three domains of life. Bacteria, Archae, and Eukarya are the…

Q: Choose 1 (ONE) Protozoa per Class. Create a table indicating the following information: Mode of…

A: Protozoa refer to the single-celled microscopic animals comprising a phylum or a group of phyla.…

Q: Which among the following does nothave a cell wall?A. Euglena…

A: The organism is the individual entity that embodies the properties of life. It is classified into…

Q: The image below is a representative of protozoa known as O G. lamblia O E. coli O A. vaginalis O C…

A: Microbiology is the branch of science which deals with the study of microscopic organisms such…

Q: Which is the correct way to denote the scientifi c name of a microorganism? a. e. coli.b. E. coli…

A: Step 1 Nomenclature is providing proper, specific, and distinguishing names to each and every…

Q: DNA Flagella PIli Escherichia coli a. What is the name of organism? Blank 1 b. Write the name of the…

A: The picture is of bacterial cell. There are found no distinct nucleus in the cell.

Q: Which of the following is FALSE when describing Bacteria? eukaryotes O unicellular O Domain Bacteria…

A: BACTERIA These are the oldest organisms existing on the Earth. These are the unicellular organisms…

Q: A. Entamoeba hartmanni B. Entamoeba coli C. Entamoeba polecki

A: Note: As Per Guidelines, We Can Answer One Question or 3 subparts per question. Ask Again To get…

Q: Euglena forms palmella. Comment.

A: Euglena is a genus of more than 1,000 species of unicellular, flagellated microorganisms that…

Q: If you have two yeast strains, (One pathenic and one not) how could you tell which one causes…

A: A pathogen is defined as a microorganism that causes, or can cause, disease. A pathogen is a microbe…

Q: apparatus. The cell bodies of the organisms were pear-shaped with pointed posterior part, large…

A: Protozoa Are unicellular microscopic eukaryotes with a rather complicated internal structure &…

Q: From the given option below what is the community of prokaryotes surrounded by slime and adhering to…

A: Prokaryotes are organisms whose cells lack a true nucleus and other membrane bound organelles. Some…

Q: The mold that produces penicillin is Penicillium notatum. enicillium is the name of its (a) genus…

A: Penicillin was discovered by Alexander Fleming as the metabolic by-product of the fungus Penicillium…

Q: Choose which organism does not belong to the group and indicate the reason for your choice A.…

A: Organisms belonging to protozoa are microscopic. Some of them can cause diseases. However, some…

Q: a. Bacteria – Escherichia coli; Neisseria catarralis; Vibrio coma b. Algae – nostoc, anabaena,…

A: BACTERIA Escherichia coli:- E. coli are harmless and actually are an important part of a healthy…

Q: Bacteria Viruses Protozoa Fungi The name of Spirillum Ebolavirus Flagellates Molds the organism and…

A: Bacteria Virus Protozoa Fungi Name of the organism Spirillum Ebola virus Flagellates Molds…

Q: A Moving to another question will save this response. stion 23 Which bacterial structure is found…

A: Bacteria is a unicellular prokaryotic cell. It has a simple structure with few organelles present…

Q: Choose which organism does not belong to the group and indicate the reason for your choice A.…

A: All organism given in the question belongs to the kingdom Protista.

Q: range of antibiotics is produced by bacteria related to: (choose only one) a) Bacillus b)…

A: The answer to the question is Streptomyces.

Q: Complete the table: Cyanobacteria Shape of cell Arrangement of cells Other important cell feature…

A: Cyanobacteria are also known as blue-green algae. It is a photosynthetic bacterium, and some of them…

Q: Word bank: bacteria, archaea, algae, fungi, protozoa, invertebrates Blank 1________ never cause…

A: Bacteria , algae , fungi , protozoa can cuase diseases in humans. Many invertebrates are also…

Q: Give at least 5 Genus and Species under G(+) cocci

A: Gram positive cocci- Staphylococcus aureus. Micrococcus luteus . Staphylococcus saprophyticus…

Q: Which of the cells shown would NOT have peptidoglycan cell walls? Choose all that apply. O Cell #1…

A: All living bodies-plants, animals or microscopic organisms, are made up of cells. The term 'cell' is…

Q: Which of the specimen(s) is a eukaryote cell? A. lymphocyte and red blood cells B. dust mite…

A: Prokaryotic cells are cells that do not have a true nucleus or membrane-bound organelles such as…

Q: Bacteria O a. Are the most familiar prokaryotes compared with Archaebacteria O b. All the other…

A: Bacteria are the microscopic organisms and they are single-celled. Bacteria are found in almost…

Q: Which of the fóllówing describes a groups of 4? 1) tetrad 2) sarcina O 3) diplococci O 4)…

A: Answer is option a.) tetrad.

Q: art III VARNING! IMPORTANT SAFETY RULES ways wash your hands well with soap and water after h- gs…

A: An egg is composed of white and yolk. The yolk can be yellow or orange color. The color of the yolk…

Q: Formation of a(n______) allows some soil bacteria to survive adverse conditions. a. pilus c.…

A: Introduction:- Microorganisms are adaptable to their surroundings, able to detect and adapt to their…

Q: In 1894 used a corpse and figured out that a was responsible for the symptoms of the plague. O Louis…

A: Louis Pasture gave rabies vaccine, anthrax vaccine, cholera vaccine and also gave the pasteurisation…

Q: Survival mech. for some gram pos. bacteria, spores are highly resistant dormant form of bacteria

A: Bacteria are classified into gram-positive and gram-negative based on the result of the gram stain…

Q: Give a reason why there’s a higher abundance of bacteria swabbed from the front of the compared ti…

A: Bacteria are prokaryotic organisms found everywhere.

Q: Which group of bacteria are missing a nucleus? 1. proteobacteria 2. green bacteria 3.…

Concept explainers

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.

Question

DNA
Flagella
Pili
Escherichia coli
a. What is the name of organism? Blank 1
b. Write the name of the kingdom. Blank 2
Last saved 6:18:34 PM
mgining

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Drag and drop the labels into the correct empty boxes to complete the concept map. serotype Kingdom bacillus spirochete Domain genus species cocci Borrelia burgdorferi Reset Archaea subspecies Ancestral Cell Line Bacteria strain exhibit differing characteristics Photo - Source: CDC/Claudia Molins/Janice Haney Carr Eukarya stimulates a distinct pattern of antibodies
Shigella Sonnei A short paragraph on the habitat of the organism. A short paragraph on the special characteristics of the organism. And a short paragraph on the clinical significance of the organism. please attach references!
Help indetifying the unknown bacteria ? Gram Stain: Purple Cell Morpholgy: Rods Oxygen Requirement: OA Acid Fast Stain: pink Endospore Stain: pink rods Blood agar-hemolysis: no lysis Phenol red-glucose fermentation:red,no gas Phenol red -lactose fermentation:red,no gas Phenol red - mannitol fermentation:red,no gas Phenol red-sucrose fermentation: red,no gas Methyl red:no change Voges-Proskaur: no change Oxidase: no change Catalase: bubbles Nitrate Reduction: red after a & b
Help indetifying the unknown bacteria ? Gram Stain: Pink Cell Morpholgy: Bacillus Oxygen Requirement: OA Acid Fast Stain: green Endospore Stain: pink rods Blood agar-hemolysis: lysis (yellow clearing) Phenol red-glucose fermentation:red,no gas Phenol red -lactose fermentation:red,no gas Phenol red - mannitol fermentation:red,no gas Phenol red-sucrose fermentation: red,no gas Methyl red:no change Voges-Proskaur: no change Oxidase: purple Catalase: bubbles Nitrate Reduction: red after zinx
QUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Please someone help me, please chose other than T.Brucei and Diatoms thabk you
Give typing answer with explanation and conclusion Which of the following are groups of microbes? Select all correct answers. Group of answer choices Bacteria Archaea Chromosomes Fungi Antibodies Viruses Protozoa Plants
Write a paragraph on Bacteria.
ean.khpcontent.com/biology/page/ch23pretest?type question-list&page_type-6896389 D YouTube * Maps raprer 1 Ablgall CAMERON- October 03, 2021 12:45:43 PM Return to Site 4. 56 1 3 9 10 11 12 13 14 15 16 17 (15 of 17) Match each group in the left column with the corresponding grouping in the right column. Marchantiophyta А. Non-vascular plants Lycopodiophyta В. Seedless vascular plants С. Pterdiophyta Non-vascular plants D. Seedless vascular plants Bryophyta E. Non-vascular plants Anthocerophyta Note: Clicking any button other than the Save Answer button will NOT save any changes to your answers! Save Answer Skip Question I Am Finished/Submit for Grade
Create a dichotomous key to distinguish each of these organisms. Use taxonomy to divide initially, but laboratory tests may also be used. Escherichia coli Candida albicans Penicillium notatum.
Complete the table: CYANOBACTERIUM SHAPE OF CELL ARRANGEMENT OF CELLS OTHER IMPORTANT CELL FEATURE DISTRIBUTION IMPORTANCE Oscillatoria sp. Spirulina sp.