Q: (b) (1) Explain the term reflex action. (ii) Expand the following biological abbreviations: (1) DNA ...
A: The human body is comprised of several body systems that work together in order to maintain day-day ...
Q: If there were to be an abrupt change in the climate system, what would be the effect on human civili...
A: Climate change refers to long-term shifts in temperatures and weather patterns or the change in the ...
Q: Which of these is measured by placing a dollar value on different aspects of biodiversity? Group of ...
A: Biodiversity: it represent the all types of life forms exist in this natural world including animals...
Q: 3. What do the patterned bands represent?
A: Agarose Gel Electrophoresis is a molecular technique used to separate fragments of DNA based on thei...
Q: how does an organism maintains homeostasis through the interaction of the various organ systems in t...
A: Homeostasis, from the Greek words for "same" and "steady," refers to a self-regulating process by wh...
Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...
A: A gene is a sequence of DNA that codes for a specific protein. Proteins are the building blocks of o...
Q: What is the significance of putting scale bar in photomicrographs?
A: Scale bar:A scale bar is an instrument or software that attaches to a slide or image when it is imp...
Q: Why did Staphylococcus aureus appear in golden yellow color. And the way to differentiate between St...
A: Introduction: Staphylococcus is a group of bacteria that can cause a number of infectious diseases ...
Q: How do we know that core-promoter elements are importantfor transcription?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: In Figure 6-21, propose a specific genetic explanationfor individual Q (give a possible genotype, de...
A: Examples of diseases showing an incomplete penetrance are Huntington's disease and breast cancer. Bo...
Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.). Why would it be use...
A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...
Q: Did an Error Cleaning Mouse Cages Alert Us to the Dangers of Bisphenol A?
A: BPA is quite dangerous for human beings. BPA has a tendency to go through the bodies of humans in a ...
Q: Assume for simplicity that height is a discrete characteristic that is affected most strongly by a s...
A: Dutch populations have highest height in entire world.
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...
Q: Select all the following statements that are TRUE regarding viruses: □ All viruses are potentially ...
A: viruses- is a microscopic non cellular living organism. viruses are surrounded by protein coated lay...
Q: A woman will give birth to a triplets without knowing the gender. What is the probability of having ...
A: A multiple pregnancy occurs when you are pregnant with more than one child at the same time. Twins a...
Q: How do the Miocene fossil primates differ from the Oligocene fossil primates? Thank you so much!!
A: INTRODUCTION All these Primate may reveal for adaptations for climbing the trees. The primates...
Q: Which of the following is a risk factor for the development of cancer, but not also for diabetes and...
A: Risk factors for development of cancer : Tobacco Exposure to radiation Specific Chemicals Older age...
Q: What is the climax stage of an ecological succession?
A: Introduction:- Ecological succession is the process that describes how the structure of a biological...
Q: Find a protein of your choice, choose a part of it (containing at least 30 amino acid residues), fin...
A: Proteins are the working machinery of the cell. They are made up of amino acids that are linked to o...
Q: Which temperature is Taq polymerase's optimal temperature O 20 degrees C 72 degrees C 55 degrees C O...
A:
Q: Look at the equation for photosynthesis and try to explain a basic overview of the process of photos...
A: Photosynthesis It is defined as the process through which plants use the sunlight to convert the li...
Q: 1. Explain what "optimum" means. Do all enzymes have the same optimum pH and temperature?
A: Optimum means a state at which the best of a reaction or outcome occurs.And it is a level at which t...
Q: Statement of the Problem of the ampalaya
A: Ampalaya Its scientific name is Momordica charantia. It belongs to the family Cucurbitaceae. It is w...
Q: What are the main natural plant hormones and what are their respective effects?
A: Introduction In this question we have to write the main natural plant hormones
Q: Briefly explain the importance of several receptors in aquatic environment. Provide concise examples...
A: Environmental receptors: they are used in ecological risk assessment.
Q: motner nas a nign neteroplasmiC load in ner germ celiS (celis that Will produce ner eggs). Which the...
A: Within a cell or person, heteroplasmy refers to the existence of more than one form of organellar ge...
Q: Red-flowering snapdragons are homozygous for allele R1. White-flowering snapdragons are homozygous f...
A: Introduction :- Homozygous inheritance is a genetic condition in which a person inherits the same al...
Q: Which of the following statements is most likely behaviorally when applied to a male primate with a ...
A: Introduction: When male and female individuals are distinguished externally, the phenomenon is calle...
Q: please help 2 questions 1) how can you tell the difference between male and female fruit fly? 2) ...
A: fruit fly also called drosophila melanogaster is an extensively studied fly for genetically linked t...
Q: Why is evolution important in explaining the diversity of life
A:
Q: CHOICES: 36 72 18 9 144 If a gamete of an unknown animal species has 18 chromosomes, 1. how many c...
A: 1. Gamete of any species have half the total number of the chromosomes of that of the organism in th...
Q: does the process of evolution drives the diversity
A: The branch of biology which deals with the study of heredity and evolutions known as the genetics. T...
Q: Consider two blood polymorphisms that humans have in addition to the ABO system. Two alleles LM and ...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: A glass spreader can be sterilized by dipping in 70 % ethanol and burning of excess False .a True .b
A: Introduction:- Spreaders, also known as cell spreaders, are laboratory instruments that allow sample...
Q: Photosynthesis in some of the crops is efficient at this range of temperature a. 20°C - 30°C ...
A: Photosynthesis is the process that produces organic matter from simple inorganic molecules, using su...
Q: In 1965, Jon Beckwith and Ethan Signer devised a method of obtaining specialized transducing phages ...
A: Introduction: An operon is a functioning unit of genomic DNA that contains These a genes group of ge...
Q: Which of the following would NOT occur as a result of regular exercise to a specific muscle group (a...
A: The exercising involves the training of muscles by putting heavy load on them, due to exercising the...
Q: Determine what amino acid will be formed from the given DNA strand below: ...
A: Transcription Formation of RNA over DNA template is called transcription. Out of 2 strand of DNA on...
Q: simple words, explain the role of feedback mechanism in maintaining homeostasis
A: Introduction:- The tendency to resist change in order to maintain a stable, relatively consistent in...
Q: 2. In horses, black coat color is influenced by the dominant allele (B) and chestnut coat color is i...
A: The recessive characteristic will only be displayed in offspring with two copies of the recessive ge...
Q: Joshua Tree National Park hosts several species, including the cactus wren, creosote bush, kangaroo ...
A: Ecological levels of organizations are as follows :-
Q: 1. Read the paragraphs below. For each paragraph, write the letter of the diagram from the diagram s...
A:
Q: Select all the characteristics that apply to BACTERIA but not Eukaryotes. □ lack membrane bound-org...
A: Introduction: Bacteria is a single celled prokaryotic organism. Their cell structure is simpler than...
Q: How do these work? i. Artificial selection ii. Natural Selection iii. Gene flow iv. Non-random matin...
A: Introduction :- Selective breeding is the process of humans using animal and plant breeding to selec...
Q: What is a xaxim?
A: Introduction :- Xaxim is a pteridophyte with an aerial stem that is normally perpendicular to the so...
Q: How do plants control the opening and the closing of stomata?
A: Introduction: Stomata is present on the leaves of plants. They are tiny pores that help the plant to...
Q: How is a phylogenetic “bootstrap value” calculated? Simplify and show the steps
A: Bootstrap value in phylogenetics is the value out of 100,which is the number of times the same branc...
Q: A woman will give birth to a quadruplets without knowing the gender. What is the probability of havi...
A: 1.Given, Quadruples are born.And the total possible outcomes are 2 power 4 i.e16. And t...
describe why fehling's test is not an accurate for blood-glucose levels?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the difference between a quantitative and a qualitative test for the determination of blood glucose?What are the other methods of detection for blood glucose determination? Explain the principle involved.I need to see a line graph for the following data and which (if any) of the individuals (A or B) has diabetes? Also, if the time period was extended to six hours, what would the expected glucose level for Person B be?
- What are the sources of error in glucose determination?Explain why a common diagnostic test for diabetes involves orally administering a glucose solution to an individual and then measuring the concentration of blood glucose two hours later.Describe the technique for obtaining a blood glucose level.
- Which of the following fasting blood glucose results would be considered normal? 76 mg/dl 126 mg/dl 54 mg/dl 102 mg/dlWhat is the normal blood sugar range for someone without diabetes?Hyperphosphatemia is found in diabetes mellitus and starvation, justify this statement. (Subject: Clinical biochemistry)
- What do Judy’s Glucose Tolerance Test results mean? A table with abnormal GTT values is provided below. Provide specific recommendations for Judy based on her GTT results.What is the lowest glucose concentration that Benedict's quantitative test can detect and how reproducible are the results?PR Glucose (A/G) is reliable or not?