Define altepetl
Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?
A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…
Q: not useful to infer evolutionary history in creating this
A: A phylogenetic tree, often called a phylogeny, is a diagram that shows how various species, animals,…
Q: What would be the modifier to add to this HCPCS code?
A: HCPCS Level II codes are a combination of alphabets and numerals assigned to medical services,…
Q: When YO2 = 0.5, the value of pO2 is defined as _______ (see the graph in Model 1).
A: Consider the following reaction: where P is the protein, L is the ligand and k1 and k2 are rate…
Q: 4. Who covers the cost of genetic testing? Is this approved by most insurance carriers? If the test…
A: Genetic testing is a type of medical test that examines an individual's DNA, the genetic material…
Q: 5. The patient has an order for Ampicillin 450 mg IV q (every) 6 hrs. The nurse has available a 500…
A: Given Patient's order for ampicillin:- 450 mg IV every 6 hourly. Nurse has a vial of 500 mg. The…
Q: What is the complementary strand of TTGACAGTAAAA?
A: Deoxyribonucleic acid (DNA) consists of two polynucleotide chains which are held together by…
Q: Do you expect worms with defects in unc-17 become hyper contracted and paralyzed by aldicarb
A: Introduction: The neurotransmitter acetylcholine (ACh), which causes overstimulation of cholinergic…
Q: Build a plypeptide DNA: TAC-TCC-CGG-GTT-ACC-ACT
A: DNA is the genetic material of the organisms like humans. The DNA is transcribed into the RNA by the…
Q: Lebel and give typed explanation
A: There are a few important points : Cell is the structural and functional unit of life. On the basis…
Q: which organell is directly outside of the nucleus?
A: Introduction:- Cell is the basic structural and functional unit of life. Cells are of two types, on…
Q: Why is the placement of the trp operator important?
A: Trp operon It constitutes five genes that are responsible for encoding enzymes required for…
Q: Can you please help find what the n terminal is?
A: The pH of the solution is determined by measuring the acidity and basicity. The pH of less than 7 is…
Q: Amino acid +Amino acid >Dipeptide +______
A: Proteins are macromolecules composed of monomeric units called amino acids. These amino acids are…
Q: please explain the question, i am unable to input values of x
A: The dependent variable, the reaction rate (µmol/L/min), is usually plotted on the y-axis and is…
Q: Explain a briefly notes on translation?
A: The central dogma of biology explains the flow of information from genes to protein by two…
Q: 3 6 9 12 15 18 21 24 5 -GGGGA GAA CGA G ACA AT C TG C TC G 3' 3' -CCCCT CTT GCT C TG T TA G AC G AG…
A: Nitrogenous bases in DNA are purines and pyrimidines. Purines in DNA are Adenine(A) and Guanine(G).…
Q: At pH 1, the charge on the C-terminal carboxyl group is
A: Peptide bond: When two amino acids are joined together releasing a water molecule and forming alpha…
Q: A. Matching Match each description listed on the left with its correct structure on the right. A.…
A: In auditory physiology, various structures and conditions play crucial roles in our perception of…
Q: describe the term replicon
A: Replication is a process thatindudes various proteins and their complexes to form copies of DNA…
Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC
A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…
Q: Questions 1. Who are the characters in this real-life scenario? What medical situation does each of…
A: We all know that our all physiological information are stored in our genetic material,DNA.But if…
Q: Explain why orthologs have sequences that are similar but not identical.
A: A homologous trait can be described as a homolog also spelled homologue. In terms of genetics, the…
Q: What is the difference between the vibratory movement of the translation movement?
A: Given: To know the difference between vibratory and translation movement.
Q: If a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a…
A: Genetic code refers to the triplets of nucleotides each of which code for a specific amino acid. The…
Q: is/are performed by 2. Equation(s) consumers, and equation(s) is/are performed by producers. a. I,…
A: Introduction: All organisms on earth require input of energy from its environment. we know that…
Define altepetl

- The altepetl was the regional, ethnically established political commodity generally interpreted into the language of English as a "city-state," during the interval of pre-Columbian communities in the Americas.
- Every altepetl had its jurisdiction, and its personal story of origin and assist as the primary centre of Indigenous individuality.
- During that time, even residents of a community are known by the name of their altepetl.
Step by step
Solved in 2 steps with 1 images
