Count how many uppercase letters are in the input. Program must have a function called count_upper that takes two arguments: an integer denoting the length a character sequence and a string representing the character sequence. It counts the number of uppercase letters found in the character sequence. It returns an integer value indicating how many uppercase letters the sequence contains.

Count how many uppercase letters are in the input. Program must have a function called count_upper that takes two arguments: an integer denoting the length a character sequence and a string representing the character sequence. It counts the number of uppercase letters found in the character sequence. It returns an integer value indicating how many uppercase letters the sequence contains.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

please complete the following program in c++ and avoid using any advanced manipulators, strings, or global variables. Thanks
C++ PROGRAMMING Create a C++ program that accepts an English sentence and converts it to Pig Latin. The rules of Pig Latin are as follows: If the word starts with a vowel, add the word "yay" in the end. If the word starts with a consonant, move the first letter of the word in the end and add "ay" in the end. If the word starts with a capital letter, follow the rule and convert the first letter of the converted Pig Latin word into a capital letter. (i.e. Hello -> ElloHay) If there are numbers in the sentence, they should not be translated. A word with a combination of letters and numbers will not be tested. Spacing and punctations must be preserved. Sample Input: A quick brown fox jumps over the 100 lazy dogs. Expected Output: Ayay uickqay rownbay oxfay umpsjay overyay hetay 100 azylay ogsday.
Summary In this lab, you complete a C++ program with the provided data files. The program calculates the amount of tax withheld from an employee’s weekly salary, the tax deduction to which the employee is entitled for each dependent, and the employee’s take- home pay. The program output includes state tax withheld, federal tax withheld, dependent tax deductions, salary, and take-home pay. Instructions Ensure the source code file named Payroll.cpp is open in the code editor. Variables have been declared and initialized for you as needed, and the input and output statements have been written. Read the code carefully before you proceed to the next step. Write the C++ code needed to perform the following: Calculate state withholding tax (stateTax) at 6.5 percent Calculate federal withholding tax (federalTax) at 28.0 percent. Calculate dependent deductions (dependentDeduction) at 2.5 percent of the employee’s salary for each dependent. Calculate total withholding (totalWithholding)…
Note:solution using c++ language Pre-Lab 01: Write a program that reads a positive integer x from the user. If x is even, the program prints all the odd numbers between 1 and x – inclusive - each on a separate line. If x is not even, the program prints all the numbers that are multiples of 4 between 1 and x+10 -inclusive -, each on a separate line. Note: As long as the user does not enter a positive number, the program will repeatedly ask the user to enter a positive number. The program must also print an error message "Error- TRY AGAIN – You should enter a positive integer to continue". Úe do.. while to insure the user input.
In C++ Programming, write a program that calculates and prints the monthly paycheck for an employee. The net pay is calculated after taking the following deductions: Federal Income Tax: 15% State Tax: 3.5% Social Security Tax: 5.75% Medicare/Medicaid Tax: 2.75% Pension Plan: 5% Health Insurance: $75.00 Your program should prompt the user to input the gross amount and the employee name. The output will be stored in a file. Format your output to have two decimal places. A sample output follows: Bill Robinson Gross Amount: .......................... $3575.00 Federal Tax: ................................ $ 536.25 State Tax: .....................................$ 125.13 Social Security Tax: ................... $ 205.56 Medicare/Medicaid Tax: ......... $ 98.31 Pension Plan: .............................. $ 178.75 Health Insurance: .......................$ 75.00 Net Pay: ....................................... $2356.00 NOTE: The first column is left-justified, and the right column is…
Destructor, copy constructor and operator= are special functions provided by C++. Group of answer choices True False
Instruction: It should be a C++ PROGRAM INCLUDE THE HEADER FILE, MAIN CPP, AND BSTREE.CPP There is a real program developed by a computer company that reads a report ( running text ) and issues warnings on style and partially corrects bad style. You are to write a simplified version of this program with the following features: Statistics A statistical summary with the following information: Total number of words in the report Number of unique words Number of unique words of more than three letters Average word length Average sentence length An index (alphabetical listing) of all the unique words (see next page for a specific format) Style Warnings Issue a warning in the following cases: Word used too often: list each unique word of more than three letters if its usage is more than 5% of the total number of words of more than three letters Sentence length : write a warning message if the average sentence length is greater than 10 Word length : write a warning message if the…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Create a C++ code to calculate the zero or root of a particular equation using the "Secant Method". Also, the user should be allowed to choose which equation they are solving from a list of 5 different equations. You should choose a variety of equations that demonstrate the capability of your program to accurately calculate roots for different types of equations. PLEASE DO THIS IN C++
c++ problem. paste indented code here
C++ write a program that inputs 10 integers from the user and passes them one at a time to the function is even which returns true if the integer is even and false otherwise. The program should print whether each of the integers is even or not.
Programming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replace