Cortisol release is the result of activation of the while testosterone release is caused by activation of the basal ganglia nucleus accumbens parietal cortex ventral tegmental area thalamus HPG axis HPA ais cerebellum prefrontal cortes

Q: Question 5 of 10 Among the given statements, which one(s) is/are correct about alpha keratin? 1. It…

A: Alpha-keratin is a protein found in vertebrates. It is found in nails, hairs, claws and epidermis of…

Q: Why is it 2n-2?

A: A molecule is called chiral molecules if it cannot be superposed on its mirror image by any of A…

Q: 8 What are the three components of anucleotide?

A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…

Q: Draw 9:51 am / Draw 9:51 am / -u deleted this message 9:51 am What are the Amino acids and the…

A: Amino acids are biomolecules that are composed of an alpha carbon bonded to 4 groups. They are; a…

Q: What do you mean by Nissl's granules?

A: Nissl's granules are part of neurons. They perform very important functions and hence is vital for…

Q: Define renin

A: Renin was first discovered by Tigerstedt and Bergman in 1898 in the saline extracts of rabbit…

Q: To maximize the speed with which action potentials travel through the nervous system, which is the…

A: (B) option is correct answer.   action potential travels faster if out myelin sheath is stronger and…

Q: Which is NOT an epimer of the monosaccharide below: CHO H- OH H- HO. CH,OH

A: An epimer is one of the two or more stereoisomers of the same molecule that differ in the position…

Q: CH3 CI CH3

A: The given structure has functional group chlorine and two methyl groups are attached to side…

Q: What is BP ? My BP is 100/150 . is it good or bad for my health ?

A: KEY WORDS :- BP - Blood pressure. Normal blood pressure - 120/80 MMHG.

Q: Identify the highlighted structure

A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…

Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the

A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…

Q: Why Ranitidine is better than Cemitidine? Please explain at your own words.

A: There are several drugs used to treat peptic ulcer disease. Peptic ulcer is characterized by…

Q: Tina needs 2800 calories a day to support her energy needs during training. She tends to focus more…

A: Introduction Nutrition:- It is the process of taking in food and converting it into energy for…

Q: A B C (b) [Choose ] [Choose] [Choose ] <

A: The peripheral nervous system of the body consists of several nerves and ganglia, which play an…

Q: what are centrioles?

A: Centrioles are found in most of the eukaryotic  cells.  Centrioles are surrounded by pericentriolar…

Q: 28. How do medical asepsis and surgical asepsis differ?

A: Medical refers to the field of knowledge, practice, and study related to the diagnosis, treatment,…

Q: Describe lysine degradation.

A: The amino acid is an organic acid that contains an alpha carboxyl group, alpha amino group, a…

Q: What is the K-T Boundary?

A: This boundary is a geological signature,  usually a thin band of rock. This boundary basically marks…

Q: H. TH.

A: A polypeptide is a sequence of amino acids where the amino-terminal of one amino acid is linked to…

Q: 510. Trypsin cleaves proteins after lysine and arginine residues. Trypsin itself has 13 lysine and 2…

A: By cleaving peptide bonds in the protein sequence, protease catalyzes the hydrolysis of proteins…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: what is lab value of creatinine

A: Creatinine is the breakdown product of creatine phosphate from muscle and protein metabolism .Serum…

Q: Which structure is highlighted?

A: According to our guideline we can answer only the first question. So, upload the second image…

Q: 4. G's go with A's T's C's G's

A: Nucleic acid such as RNA or DNA is composed of several nucleotides joined end to end A nucleotide is…

Q: Why is cholesterol an important steroid?

A: We can say that Cholesterol is a fatty substance that is synthesized by the liver and is circulated…

Q: 15 Explain why detergents, which have an amphipathic structure like bile salts, are able to remove…

A: Detergent- These are the powder that contains chemical properties and are used for the removal of…

Q: What are siRNAs?

A: The gene is a basic physical and functional unit of heredity. Genes are made up of DNA.The gene is a…

Q: CH, H H ОГТІ 0= II Т Н H-C- H₂C-N-C-C-O-P-OC-H CH, H H О 1 H-C-0 -Т Н 2 онннн Н II ТТГ Н Н Н Н Н Н Н…

A: A molecule is the smallest part of any substance that is made up of different atoms connected…

Q: What does the word "deppresion" really mean

A: Depression is a mental health disorder that affects a person's mood, thoughts, and behavior. It is a…

Q: (i) Why does DNA contain thymine instead of uracil? Justify.

A: Thymine and uracil are the pyrimidines present in DNA and RNA molecules respectively. Thymine…

Q: what is a a lysate.?

A:

Q: hertability refers to

A: Genetics is the branch of Biology dealing with the study of genes including their structure,…

Q: Based on the F-actin assembly data presented above, which type of actin-binding protein is Protein…

A: F- actin is a crucial protein for cellular  function and responsible for cell stability. Actin…