Cortisol release is the result of activation of the while testosterone release is caused by activation of the basal ganglia nucleus accumbens parietal cortex ventral tegmental area thalamus HPG axis HPA ais cerebellum prefrontal cortes

Q: 19. Label structure name only

A: We can say that The hypothalamus and the pituitary gland are part of the neuroendocrine system. The…

Q: Why is it 2n-2?

A: A molecule is called chiral molecules if it cannot be superposed on its mirror image by any of A…

Q: Chiral / achiral * HO. Achiral Chiral

A: Asked : If given carbon is chiral or not Given : CH3-CH2-CH(CH3)-CH2OH Marked carbon is to be…

Q: 8 What are the three components of anucleotide?

A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…

Q: Name the class.

A: In a biological hierarchy, the class is a taxonomic level; that is, it is a taxonomic unit in that…

Q: To maximize the speed with which action potentials travel through the nervous system, which is the…

A: (B) option is correct answer.   action potential travels faster if out myelin sheath is stronger and…

Q: Adenine always pairs with

A:

Q: identify the question being asked   IUPAC name for C16:0

A: The IUPAC nomenclature of organic chemistry is a technique of naming organic chemical compounds that…

Q: Which is NOT an epimer of the monosaccharide below: CHO H- OH H- HO. CH,OH

A: An epimer is one of the two or more stereoisomers of the same molecule that differ in the position…

Q: CH3 CI CH3

A: The given structure has functional group chlorine and two methyl groups are attached to side…

Q: If N<k, the value of r is negative and the population declines. Natural populations may grow at…

A: The equation for logistic growth is: dN/dt = rN (K-N)/K When N&lt;&lt;&lt;&lt;K Which means…

Q: Identify the highlighted structure

A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…

Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the

A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…

Q: Why Ranitidine is better than Cemitidine? Please explain at your own words.

A: There are several drugs used to treat peptic ulcer disease. Peptic ulcer is characterized by…

Q: Tina needs 2800 calories a day to support her energy needs during training. She tends to focus more…

A: Introduction Nutrition:- It is the process of taking in food and converting it into energy for…

Q: A B C (b) [Choose ] [Choose] [Choose ] <

A: The peripheral nervous system of the body consists of several nerves and ganglia, which play an…

Q: Define gyrus

A: The gyrus is a ridged surface on the brain in humans and mammals, found in the cerebral cortex that…

Q: what are centrioles?

A: Centrioles are found in most of the eukaryotic  cells.  Centrioles are surrounded by pericentriolar…

Q: 11 Endocrine glands are often called "ductless glands" because their products are secreted directly…

A: Endocrine glands secrete hormones. Hormones are secreted from one gland and activates the functions…

Q: explain this figure

A: Amino acids are organic molecules that contain a basic amine group (-NH2) and a carboxyl group…

Q: Define beta (b) sheet

A: Proteins have different organization levels, which gives the properly folded functional form of the…

Q: What is centriole ?

A: Centrioles are paired barrel-shaped organelles located in the cytoplasm of the animal cells near the…

Q: 28. How do medical asepsis and surgical asepsis differ?

A: Medical refers to the field of knowledge, practice, and study related to the diagnosis, treatment,…

Q: Describe lysine degradation.

A: The amino acid is an organic acid that contains an alpha carboxyl group, alpha amino group, a…

Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: L--L--F--A--I--A--M--F--L--N--I--A--I--A--I What do you think will happen if large concentrations…

A: The given peptide is L--L--F--A--I--A--M--F--L--N--I--A--I--A--I.

Q: protein folding briefly

A: Protein is a polymer of amino acids connected together via peptide bond. In a cell, proteins are…

Q: #8: What is the function of the entire indicated structure?

A: Most of the stomata are positioned in the lower epidermis while the cells of the lower epidermis…

Q: What is the K-T Boundary?

A: This boundary is a geological signature,  usually a thin band of rock. This boundary basically marks…

Q: 10.12 2. What is the clinical significance of ALT?

A: Alanine aminotransferase, or ALT, is an enzyme that is mostly found in the liver. ALT's purpose is…

Q: 70. If a commercially available insulin prepa- ration contains 1 ppm of proinsulin, how many…

A: Question is related to drug calculation Solution given below step

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: Which structure is highlighted?

A: According to our guideline we can answer only the first question. So, upload the second image…

Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…

A: Sphingosine is composed of  an amino alcohol head group, with two hydroxyls, and one amino group…

Q: & 4

A: The forebrain is divided into a diencephalon as well as a telencephalon. The latter comprises two…

Q: 4. G's go with A's T's C's G's

A: Nucleic acid such as RNA or DNA is composed of several nucleotides joined end to end A nucleotide is…

Q: Why is cholesterol an important steroid?

A: We can say that Cholesterol is a fatty substance that is synthesized by the liver and is circulated…

Q: Draw serine

A: Those organic molecules which possess two functional groups carboxylate and amino group and a…

Q: הנא (b) A section of DNA was analysed and 24% of its bases were found to be adenine. Calculate the…

A: DNA is a polynucleotide molecule made up of 4 types of nucleotides according to the nitrogen bases…