Consider the reactions in the citric acid cycle. Part 1 of 2 In which step(s) is/are NADH generated? Check all that apply. ☐ Step 1 ☐ Step 2 Step 3 Step 4 Step 5 ☐ Step 6 ☐ Step 7 ☐ Step 8 Part 2 of 2 In which step(s) is/are carbon-carbon single bonds formed? Check all that apply. ☐ Step 1 ☐ Step 2 Step 3 ☐ Step 4 Step 5 ☐ Step 6 ☐ Step 7 ☐ Step 8
Q: help please answer in text form with proper workings and explanation for each and every part and…
A: Step 1: Given: Half-life of U is T21=4.5×109years Rate…
Q: Question 5 We can determine the copper(II) ion content of a sample using spectrophotometry. The…
A: Let,x−axisrepresentamountofCu2+.Let,y−axisrepresentabsorbance. Using given table as data points, we…
Q: Given that the protein Burger is found only in the blood of patients with Sillyitis, with the aid of…
A: The Enzyme-Linked Immunosorbent Assay (ELISA) is a powerful technique used to detect and quantify…
Q: In bacteria, what is the role of the Shine-Dalgarno sequence? Question 3 options: It binds to…
A: The Shine-Dalgarno sequenceRibosomal binding site in mRNA.It enables initiation of protein synthesis…
Q: Red blood cells (RBCs) lack mitochondria, and are therefore unable to carry out oxidative…
A: To answer this question, we must take into consideration the fact that RBCs lack mitochondria and…
Q: Given the equation below, determine which statement is incorrect. 4C(s) + 6H2(g) + O2(g) →…
A: Let's analyze each statement to determine which one is incorrect:A) The result of multiplying the…
Q: Block diagrams representing the general structures of two types of lipids are drawn. Which terms…
A: I Hope this helps.If you need any further information please contact me.
Q: pless dont proved hand ratting solution
A: Step 1:The compound is written in Newman Projection. The circle indicates that it is projected in…
Q: None
A: Importance of Gamma Radiation in Diagnostic ToolsIn nuclear medicine, the utilization of…
Q: please help with this
A: Option 1 (AUCAUUCUAUUGUCCUCCACC) brings change in which UGA (encoding Cysteine) becomes UCA…
Q: I need answer expert solutions please
A: Certainly! Let's break it down:1. Composition: The disaccharide consists of two glucose molecules…
Q: 7. The diffusion constant for the membrane protein fibronectin is approximately 0.7 x 10-12 cm²/sec,…
A: For fibronectin:Dfibronectin = 0.7 x 10-12 cm2/sect = 50 x10-3 secDistance =…
Q: Be sure to answer all parts. What are [H3O+], [OH], and pH in a solution with a pOH of 9.03? Make…
A: As we know, pH+pOH=14Where pH is the power of hydronium ions and pOH is the power of hydroxide…
Q: The least developed human cells are: Question 19 options: Somatic cells (e.g.,…
A:
Q: Which of the following is the typical shape of a plot showing the rate of an enzyme-catalyzed…
A: When the concentration of the substrate is significantly higher than the concentration of the…
Q: Derive the amino acid sequence that is coded by this mRNA sequence. Use three-letter amino acid…
A: mRNA sequence:5' GGA UGG AAU UCC AAA AUC 3' The corresponding codons are:GGAUGGAAUUCCAAAAUCNow,…
Q: (8) Erythritol has been used for years as a reduced calorie sweetener (non-nutritive sweetener).…
A: Question 8: Erythritol Erythritol is a sugar alcohol (polyol) used as a reduced-calorie sweetener.…
Q: a.What is the overall ΔG°ʹ for glycolysis when starting with mannose rather than glucose?…
A: Conversion of Mannose to Fructose-6-phosphate: Mannose + ATP → Mannose 6-phosphate (ΔG°ʹ = -15.7…
Q: Describe the propagation stage of peroxidation reaction by showing peroxidation of oleic acid.…
A: Lipid peroxidation is a process that breaks down cell membranes and can cause cell damage and lead…
Q: suppose the same experiment was done using the mixture of tube 2 of this experiment( as described…
A:
Q: At what pH does Aspartate have a net charge of -1 (negative 1)? For Aspartate, the pKa of the alpha…
A: we need to consider the pKa values and determine at what pH Aspartate has a net charge of -1. The…
Q: phosphofructokinase reaction of Fructose-2,6-bisphosphate is a regulator of both glycolysis and…
A: Step 1:Step 2:Step 3:
Q: 1. List four classes of membrane-associated proteins and briefly describe the differences between…
A: FEEL FREE TO ASK FOR CLARIFICATIONS
Q: (1) Label the following statements as true or false and briefly explain your answer: (a) A…
A: 1.(a) False. The spontaneity of a process refers to whether it can occur without the input of…
Q: 4) Enzyme 1 and 2 catalyze the same reaction. Both enzymes have the same Km, but Enzyme 1 has a…
A: Km is the Michaelis constant , which is used to determine the affinity of enzyme to its substrate.…
Q: Calculate the equilibrium membrane potentials to be expected across a membrane at 37 ∘C, with a NaCl…
A: The objective of this question is to calculate the equilibrium membrane potential across a membrane…
Q: 8. Complete and balance this equation for a redox reaction that takes place in basic solution: (20P)…
A: For balancing the redox reaction in basic medium, the final equation must have OH- concentration…
Q: Identify the structure of a fatty acid is trans 16:1 (9)
A: Option a:Structure: This option shows a fatty acid chain with 16 carbon atoms and one double bond in…
Q: Please draw missing products. I need drawings!! Thank you ( please step by step answer please )
A: Step 1: LDA LDA = Lithium diisopropyl amine LDA = ((H3C)2CH)2-N-Li+LDA is a bulky base and more…
Q: Investigating the effect of water potential on osmosis in potato chips. Describe the scientific…
A: Finally, basic ideas of physical chemistry and cell biology are clarified by the experiment…
Q: Draw the skeletal structure of the alkene that is needed as a starting material to prepare each of…
A: 1. When hydration of but-1-ene is carried out in presence of peroxides it forms the desired less…
Q: The 5’ cap is involved in all the following except: Question 19 options: Splicing exons…
A: The processing of mRNA formed from transcription is called post transcriptional modification. Thes…
Q: a) How does the Grotthuss mechanism and proton translocation through the membranes differ from the…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) has been…
Q: Assuming ideal behavior, rank the solutions boiling points, 1 is lowest to 4 highest boiling point:…
A: Step 1:Boling point of solution is a collegiate property, which depends on the number of particles…
Q: 9. Consider a phospholipid vesicle containing 25 mM Na+ ions. The vesicle is bathed in a solution…
A: The objective of the question is to calculate the electrochemical potential for Na+ ions at 25 °C in…
Q: (6) The detection of a specific sugar, such as glucose, is not possible via a simple reducing sugar…
A: Answer 6 Commercial glucose test strips typically use an enzyme-based method for specific detection…
Q: Select all that are hydrolyzable lipids. Check all that apply. Vitamin K Triacylglycerol Omega-3…
A: Water can hydrolyze lipids with an ester functional group. Wax, phospholipids, glycolipids, and…
Q: Consider the following chemical reaction 21CI(g) + H2(g) 2HCI +I (g) 2(s) Write the equation that…
A: Step 1: ExplanationThe rate of a chemical reaction is defined as the change in concentration with…
Q: The following data is for the oxidation of catechol (the substrate) to o-quinone by the enzyme…
A: Phenoloxidase is a key enzyme in melanization that catalyzes the oxidation of phenols.…
Q: 3. (a) The activity of the Pentose Phosphate Pathway is commonly quantified by measuring 14CO2…
A: (a)In the Pentose Phosphate Pathway (PPP), the radioactive isotopomer of glucose that releases 14CO2…
Q: Which of the following scenarios is an example of proximity and orientation effects (select all…
A: The objective of the question is to identify the scenarios that are examples of proximity and…
Q: © Macmillan Learning Predict the amino acid sequences of peptides formed by ribosomes in response to…
A: In an mRNA sequence, a group of three bases (codon) is code for a specific amino acid. In the…
Q: Modify the mannose structures provided to show the structure of a disaccharide formed from two…
A:
Q: A 2.0% (by mass) aqueous solution of novocainium chloride (C13 H21 CIN2O2) freezes at -0.235 °C. a…
A:
Q: Model 2: Reactions of carboxylic acids and esters (3) (4) + H₂O OH (5) OH (6) 'OR' OR' + H3O® + NaOH…
A: Answer (5) Reaction number 4 in model 2 is acid base reaction Explanation:Step 1: Step 2:Step 3:…
Q: Answer each of the following with a word, phrase, or numeral (4 points each = 16 points). Please…
A: As a result of the hydrophobic effect, van der Waals contacts, hydrogen bonds, and conformational…
Q: 4-methyl-2-pentene
A: part 1. To determine the product formed when 4-methyl-2-pentene is treated with water (H₂O) in the…
Q: PLease help me fill in all the information
A: 1. Pyruvate to Alanine:Pyruvate is a three-carbon compound produced during glycolysis, which is the…
Q: Initiation of translation in E. coli requires: Question 26 options:…
A: Initiation of translation in E. coli requires several components, including:1. mRNA: The messenger…
Q: Which of the following accurately characterize glycolysis under standard biochemical conditions?…
A: The metabolic process known as glycolysis converts the six-carbon glucose molecule into two…
Step by step
Solved in 2 steps
- Consider the following reaction occurring at 298 K: OH CH₂OH OH -0. OH OH +ATP k₁ k₂ 0- OCH, OH OH 0 OH OH Glucose Glucose 6-phosphate Hexokinase is an enzyme that catalyzes this reaction. When the hexokinase is present the rate of k₁ is 1.3 X10-3 M-15-1 Calculate the activation energy for the hexokinase catalyzed forward reaction.. +ADPThe AG of the reaction C6H1206+602 --> 6 CO2 + 6H₂O is -686 kcal/mol glucose oxidized. The AG of the reaction ADP + P --> ATP + H₂O is + 7.3 kcal/mol ATP synthesized. The oxidation of glucose can be coupled to the synthesis of ATP. If the coupling is 50% efficient, how many molecules of ATP can be synthesized per molecule of glucose oxidized? Round your answer to the nearest whole number. Type your answer... rces K esc Q 7 c с 72 W #3 E 14 R LL Search or type URL % 65 T G A MacBook Pro 6 Y H & 7 U * 8 + - ( 9 J ၂ ။ K 0 ) 0 L P { + 11 } ] Submit delete returnThe AG of the reaction C6H12O6 + 60₂ --> 6CO₂ + 6H₂O is -686 kcal/mol glucose oxidized. The AG of the reaction ADP + P₁ --> ATP + H₂O is + 7.3 kcal/mol ATP synthesized. The oxidation of glucose can be coupled to the synthesis of ATP. If the coupling is 50% efficient, how many molecules of ATP can be synthesized per molecule of glucose oxidized? Round your answer to the nearest whole number.
- Indicate whether each of the following changes represents oxidation or reduction. Write: O = for oxidation ; R= for reduction Example: cyt ci (Fet) → cyt c1 (Fe2+) Answer: R Blank #1: COQH2 → CoQ Blank #2: NAD+ - NADH Blank #3: FMN → FMNH2 Blank # 4: FADH2 FAD Blank #5: Fe(III) SP → Fe(II) SP Blank # 1 Blank # 2Propose a full mechanism for the formation of the diene. Show curved arrows to illustrate electron flow, and please show all steps. Include a brief paragraph that describes the steps of the mechanism and discusses the driving force for the steps shown. (attached is the image)Solve the following problems using the basic assumptions: 1 NADH --> 2.5 ATP; 1 FADH2 --> 1.5 ATP In energy production, cells make use of carbohydrates first, lipids second, and proteins (in cases of starvation), last. Lipids undergo the beta-oxidation cycle to cut the fatty acids into 2 2-carbon Acetyl-SCoA. How many ATPs will be derived from a 10-carbon fatty acid if it goes through the said cycle and then the Kreb’s Cycle? Where will the rest of the energy go? 1 word answer.
- Write a balanced chemical equation for the pentose phosphate pathway in the first two modes depicted as shown, where (a) ribose-5-phosphate synthesis is maximized and (b) NADPH production is maximized, by conversion of the sugar phosphate products to glucose-6-phosphate for repeated operations of the pathway.Some cofactors that participate in the reactions of the citric acid cycle are indicated by letters. Identify the position of positions of NADH in the cycle by selecting the appropriate letter or letters designating its position(s) in the cycle diagram. COA CH, HO--Co, CH čo, 8 CO но-сн CH HC -Co, CO HO-CH LA Citric acid cycle H,0 co, -B COA | 4 Co, čo D.Consider 3 molecules of galactose: (write only the whole number; no decimal places) How many turns of Krebs Cycle will these molecules undergo for complete oxidation? b. How many moles of ATP are produced upon complete oxidation via malate-aspartate shuttle? c. If all the galactose molecules oxidize via pentose phosphate pathway (oxidative stage only), how many moles of NADPH will be produced?
- Give detailed Solution with explanation needed of each options....don't give Handwritten answer...don't use Ai for answering thisPage of 6 ZOOM + name: 3. In the last reaction of the citric acid cycle, malate is dehydrogenated to regenerate the oxaloacetate necessary for the entry of acetyl-CoA into the cycle: L-Malate + NAD+ → oxaloacetate + NADH + H* AG'° = 30.0 kJ/mol (a) Calculate the equilibrium constant for this reaction at 25 °C. (b) Because AG°' assumes a standard pH of 7, the equilibrium constant calculated in (a) corresponds to [oxaloacetate][NADH] Keq [L-malate][NAD*] The measured concentration of L-malate in rat liver mitochondria is about 0.20 mM when [NAD*]/[NADH] is 10. Calculate the concentration of oxaloacetate at pH 7 in these mitochondria. (c) To appreciate the magnitude of the mitochondrial oxaloacetate concentration, calculate the number of oxaloacetate molecules in a single rat liver mitochondrion. Assume the mitochondrion is a sphere of diameter 2.0 microns.a.Write the balanced reactions catalyzed by complex I, II, III, and 1V, and using these, write the balanced net reaction for the electron transport chain. Structures are not necessary. b. Write the balanced reaction for the ATP synthase reaction. c. Write the net reaction for Oxidative phosphorylation showing the ATP produced from NADH oxidation and FADH2 oxidation. (this is in your text) d. Write the balanced reaction for ATP production by aerobic metabolism starting with glucose.
