CIS 25 Fall 2023 - Homework #1 - Page 5 of 7 C++ Programming CIS 25 Laney College Your Name - Information Assignment: Implemented by: Required Submission Date: 2023/09/18 Actual Submission Date: ____/__/__ HW #1 Exercise #1 Your Name Enter an integer: -294258 -294257 is negative and even! // OUTPUT Sample Run #3 We write code to manipulate data, which are provided by the user(s), to produce the required outcome in the most efficient way! CIS 25 C++ Programming Laney College Your Name

CIS 25 Fall 2023 - Homework #1 - Page 5 of 7 C++ Programming CIS 25 Laney College Your Name - Information Assignment: Implemented by: Required Submission Date: 2023/09/18 Actual Submission Date: // HW #1 Exercise #1 Your Name Enter an integer: -294258 -294257 is negative and even! // OUTPUT Sample Run #3 We write code to manipulate data, which are provided by the user(s), to produce the required outcome in the most efficient way! CIS 25 C++ Programming Laney College Your Name

Name: Enter an integer: -29-29 is negative and odd!// OUTPUT Sample Run #2W
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: Enter an integer: -29-29 is negative and odd!// OUTPUT Sample Run #2We write code to manipulate data, which areprovided by the user(s), to produce therequired outcome in the most efficient way!CIS 25 Fall 2023 - Homework #1 - Page 5 of 7CIS 25 C++ P

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter7: Arrays

Section: Chapter Questions

Problem 8PP: (Statistical) In many statistical analysis programs, data values considerably outside the range of...

See similar textbooks

Similar questions

array is stored in an external txt file Programming must be in C language, and not use Break, pass, continue, goto or return
Instruction: It should be a C++ PROGRAM INCLUDE THE HEADER FILE, MAIN CPP, AND BSTREE.CPP There is a real program developed by a computer company that reads a report ( running text ) and issues warnings on style and partially corrects bad style. You are to write a simplified version of this program with the following features: Statistics A statistical summary with the following information: Total number of words in the report Number of unique words Number of unique words of more than three letters Average word length Average sentence length An index (alphabetical listing) of all the unique words (see next page for a specific format) Style Warnings Issue a warning in the following cases: Word used too often: list each unique word of more than three letters if its usage is more than 5% of the total number of words of more than three letters Sentence length : write a warning message if the average sentence length is greater than 10 Word length : write a warning message if the…
Assignment Write a program in C that converts temperatures between Fahrenheit, Celsius, and Kelvin. Functional Requirements • MUST correctly convert temperatures between scales • MUST read input by prompting the user Nonfunctional Requirements • MUST compile without warnings and errors • MUST print error message "Invalid temperature scale" on invalid input • MUST return 0 on success • MUST return non-0 value on failure Sample run $ ./temp Enter input temperature: 18c 18.00 C converts to: 64.40 F 291.15 Κ The conversion formulas are listed below: Celsius = (Fahrenheit - 32) / 1.8 Kelvin = Celcius + 273.15
2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…
Create a Python application that makes use of inputs, outputs, and sequence structures in Python. It must meet all of the following requirements: The application must create a list with exactly 10 items. The contents and type of list will be up to the student (e.g. Phone Brands, Types of Shoes, Shopping Apps). The application must first display the list after which the application must remove 5 random items from the list. The application must then show the updated list with 5 of the items removed. After this is done, the application must add 7 new items to the list. These items must be completely new and not the ones that were on the list initially. The application must then output the updated list with the added items. The application must then reverse the list and then display the updated list after it has been reversed. The application must create a tuple with exactly 10 items. The contents and type of tuple will be up to the student (e.g. Laptop Brands, Types of Pants, Game Apps).…
python
SUBJECT NAME IS C++: WAP to read 4 student objects and write them into a file, then print total number of student number in file. After that read an integer and print details of student stored at this number in the file using random access and file manipulators
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
In Pseudocode #7 – List 4 main data types we used in this course and describe the data that is stored in each one. List examples of variable names that make sense for each data type. #8 – Debug this input validation function and fix it. There is a lot wrong with it! Function Integer getNumberGreaterThanX(msg, x) myInteger = getInteger(msg) While myInteger < x Display "The number must be < “, myInteger , “. Try again." Input x End While End Function Write the corrected function below: #9 – Write a validation function based on the provided variables and call statement below. The validation function should return an Integer value greater than zero or print an error message until an acceptable value is entered. Declare Integer positiveValue = 0 Declare String message = "Enter the year you were born (no negative numbers!)" positiveValue = getNumberGreaterThanZero(message) Write the function definition below:
Consider the following pseudo code, Method func() { PRINT “This is recursive function" func() } Method main( { func() } What will happen when the above snippet is executed?
Help with c program using FILE HANDLING (fopen, fputs, fgets, etc.) You can also test the program with the following input.txt file A1, A2 20294 Lorenzana Dr Woodland Hills, CA 91364 B1, B2 19831 Henshaw St Culver City, CA 94023 C1, C2 5142 Dumont Pl Azusa, CA 91112 D1, D2 20636 De Forest St Woodland Hills, CA 91364 A1, A2 20294 Lorenzana Dr Woodland Hills, CA 91364 E1, E2 4851 Poe Ave Woodland Hills, CA 91364 F1, F2 20225 Lorenzana Dr Los Angeles, CA 91111 G1, G2 20253 Lorenzana Dr Los Angeles, CA 90005 H1, H2 5241 Del Moreno Dr Los Angeles, CA 91110 I1, I2 5332 Felice Pl Stevenson Ranch, CA 94135 J1, J2 5135 Quakertown Ave Thousand Oaks, CA 91362 K1, K2 720 Eucalyptus Ave 105 Inglewood, CA 89030 L1, L2 5021 Dumont Pl Woodland Hills, CA 91364 M1, M2 4819 Quedo Pl Westlake Village, CA 91362 I1, I2 5332 Felice Pl Stevenson Ranch, CA 94135 I1, I2 5332 Felice Pl Stevenson Ranch, CA 94135 N1, N2 20044 Wells Dr Beverly Hills, CA 90210 O1, O2 7659 Mckinley Ave Los Angeles, CA 90001…
Create a C++ Grocery Program according to this guideline: Linked List Functions Pointers Arrays The program must have a menu layout where the user can select certain action (Select Product, View My Cart, Check-Out, etc.) You must include all kinds of drinks/beverages Implement basic error tapping IYou must include the group name of the developers with the name of each developer (a total of 4) Group Name: In-Out Group Names: Cesar Rachel Jennifer Tom