Check the box under each molecule for which the statement in the first column is true. statement In order to do its job, it must have an amino acid attached. When attached to a ribosome, it "reads" each codon in a messenger RNA and supplies the matching amino acid. It has a sugar-phosphate backbone to which are attached many adenine, uracil, cytosine, or guanine bases. When attached to a DNA molecule, it causes the process of replication to begin. It's made in the nucleus, and unlike other nucleic acids remains there to do its job. messenger ribosomal RNA RNA 0 0 [EE] ▸ Oolo Ar 9

Check the box under each molecule for which the statement in the first column is true. statement In order to do its job, it must have an amino acid attached. When attached to a ribosome, it "reads" each codon in a messenger RNA and supplies the matching amino acid. It has a sugar-phosphate backbone to which are attached many adenine, uracil, cytosine, or guanine bases. When attached to a DNA molecule, it causes the process of replication to begin. It's made in the nucleus, and unlike other nucleic acids remains there to do its job. messenger ribosomal RNA RNA 0 0 [EE] ▸ Oolo Ar 9

Name: BIOLOGICAL MACROMOLECULESIdentifying the major types of RNA from a de
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: BIOLOGICAL MACROMOLECULESIdentifying the major types of RNA from a descriptionCheck the box under each molecule for which the statement in the first column is true.statementIn order to do its job, it must have an amino acid attached.When attached to

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.2: Information Flow From Dna To Protein: An Overview

Problem 1C: VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA,...

See similar textbooks

Similar questions

At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. mRNA in eukaryotes, can exist outside the nucleus acts as an enzyme for peptide synthesis composed of ribonucleic acid rRNA Answer Bank moves amino acids to the site of protein synthesis tRNA contains nucleotide triplets that code for specific amino acids has a convoluted structure with a three-base sequence called an anticodon moves genetic information out of the nucleus and into the cytoplasm mRNA, rRNA, and tRNA
Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.
VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.
DNA, RNA, AND PROTEIN SYNTHESIS (FILL IN THE BLANKS) GIVEN THE FOLLOWING CODING SEQUENCE FOR DNA, PROVIDE THE SEQUENCE OF THE COMPLEMENTARY(TEMPLATE) SEQUENCE. CODING SEQUENCE/ 5' ATGCATAGATTAGGATATCCCAGATAG 3' COMPLEMENTARY SEQUENCE: 3' ______________________________ 5' CODING SEQUENCE ~ mRNA transcript: 5' _______________________ 3' TRANSLATE THE GIVEN mRNA TRANSCRIPT INTO A POLYPEPTIDE SEQUENCE (REFER TO THE GENETIC CODE) POLYPEPTIDE SEQUENCE: _________________________________
es/2015347/quizzes/5825805/take The "factory" itself, made of two [Choose] subunits [Choose ] FRNA The site from which the growing polypeptide chain exits the ribosome RELEASE FACTOR CODON RIBOSOME P SITE The processed copy of DNA that UGA carries its sequence of codons to the TRNA ribosome AUG ANTICODON MRNA The carriers of each unique amino acid E-SITE to A-site of the ribosome The three letter message carried to [ Choose ] the ribosome on the "toes" of the TRNA The site from which the now empty [ Choose ] TRNA leaves the ribosome The first codon required to initiate [ Choose ] translation (on the mRNA). The binding chemical that comes along once the STOP codon is encountered: disassembles the ribosomal complex [Choosc] hp
Describe the process of translating mRNA into proteins. Be sure to also include the following key terms: tRNA, ribosomes, codon, base pairs, cytoplasm, amino acids.
Amino acid sequence: Look at the m-RNA message below: PUT A NUMBER under each of the t-RNA/amino acid complexes to show the correct sequence that they would attach as this message is read. phenylalanine leucine lysine methionine AUGUUC A A ACUG UUU UA MRNA WHAT IS THE AMINO ACID SEQUENCE FOR THE PROTEIN THAT WOULD BE PRODUCED FROM THIS MESSAGE? MATCH THE PARTS IN THE DIAGRAM WITH THE CORRECT LABEL. RIBOSOME в Asparagine D. NUCLEUS Methionine MESSENGER RNA ANTICODON E AMINO ACID CODON TRANSFER RNA
Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.
Eukaryotic ribosomes (choose all that apply) Select one or more answers and submit. For keyboard navigation... SHOW MORE ✓ a b C d e Multiple answers: Multiple answers are accepted for this question f are composed of a large subunit and a small subunit. are composed of a single RNA are composed of a single protein. are composed of multiple RNAs and multiple proteins. are always found in a constant number in a growing dividing cell. fluctuate in numbers based on the needs of the cell.
Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
Please help me find the protein sequence in reference to the text below. "mRNA Sequence Translate the mRNA sequence of HbS. 5'-AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU - 3¹ Protein Sequence 5'-"
Worksheet (Nucleic Acid) Name: Section: Date: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY SOLVED MESSAGE GIVEN: DNA code message --> GAA TAG AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATC SOLUTION (steps 1-4) 1. MRNA (built to match the DNA message, letter for letter---- → CUU AUC UUU GAA UGA AUC UCG 2. TRNA (determined by matching letters (bases) with those in mRNA)--- GAA UAG AAA CUU ACU UAG BBEE B 3. Amino acids carried by L I P G I each tRNA (according to dictionary, below)-----------> e S h e 4. Symbols of amino acids:--→ L F E