ch of the following could cause cer? Select all that apply. Genetic factors (passed on in families) Overexposure to UV radiation founlight/tanning beds)

Q: -11 -12 13 1. 14 2 15 16 3- 4 -17 18 -19 6 -20 7- -21 OBDES 9. -22 10 23

A: The circulatory system's most important organ is the heart. Its primary function as a hollow,…

Q: Could I get the history of the discovery of usher syndrome?

A: Usher syndrome is a rare genetic condition caused by a mutation in any of the ten genes involved.…

Q: D C ши I H_

A: We are given an unlabeled diagram of a cross section of flower. We have to label the diagram.

Q: How do you do this assignment?

A: You have to answer the fill in the blanks. The answers are in the snowballs jumbled. Name the…

Q: VL Illustrate the given type of epithelium and give at least 2 common locations where it can be…

A: Many cell combined to form tissues . Tissues are divided into :-  A ) Epithelial tissue  B ) Nervous…

Q: - G А. В D -K E F. L

A: Cells are the fundamental unit of life, and a number of similar cells together form a tissue that…

Q: Above Below Q A Q B C D

A:

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: IDENTIFY THE ARCUATE ARTERY

A: The kidney is a vital organ that performs many functions, one of the most important being the…

Q: Andrea is flushed and her teeth are chattering even though her bedroom temperature is 72°F. Why do…

A: When a person is flushed it means that the person turns red as they are ill or hot due to a strong…

Q: Label the ear model b D E - Y - E z o E

A: The diagram is of the internal structures of left side of the ear   NERVES  COCHLEAR NERVE…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: 28 29

A: Skeletal muscle is one of the major muscles in the body which is regulated by somatic nervous…

Q: What do you mean by Accident Exposure?

A: Biological agents are present naturally in the environment and include fungi, viruses, parasites,…

Q: The size of the pupil is controlled by the O lens

A: The eye is the sensory organ that allows us to see. The eyes achieve vision with the help of visual…

Q: needed help with 6 7 and 8

A: In this question only 6 questions Is asked 7 ,8 question not mention.

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase)  Mitosis is a type of cell division in which a cell…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: Baby monkey favorite food

A: Monkey is a common name that may refer to certain groups or species of the simian mammals of order…

Q: I was wondering if taking ap biology is a bad decission as a freshman.

A: The College Board in the United States offers the Advanced Placement (AP) Biology course and exam,…

Q: B A- E- A U D E ✓ B ✓ F- vi G- H F G D- ✓ H-

A: The image is of brain and its different parts. Brain is the most important regulatory organ of the…

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: You can get a .. at a railway ...... station. * O bus O train

A: Trains comet railway stations and buses go to bus stops that's at a railway station a train will…

Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…

A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…

Q: 外 13 A ING 11

A: The given diagram is of the base of skull.

Q: Could you please let me know if these look labeled correctly? Specifically letter f?

A: The mentioned diagram describes skin anatomy.

Q: A drug company is developing a new pregnancy-test kit for use on an outpatient basis. The company…

A: PV+ value refers to the positive predictive value in a test for a disease. It can be calculated…

Q: Janet is becoming stooped as she ages and has had several broken bones. She probably stuffer from

A: Stooping refers to the downward and forward bending of the body. Older people tend to stoop because…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Letter D please what is called!

A: The smallest structural and functional unit of an organism is known as cell which contain different…

Q: Can you help me to write the name of the label of this picture? I have a hard time to figure it out.

A: There is a pair of collar bones present in humans. Collar's bones are also known as the clavicle.…

Q: im confused, what is the answer?

A: The root system and the shoot system are the two main structures in plants. Every one of these…

Q: may u break it down a little more please

A: Integumentary system :  Integuments are the largest system of the body. It includes skin and its…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.