Below is a metamorphic field gradient, what is the likely plate tectonic setting? Explain your answer. sample P-T limits (this study) zone P-T limits (Huang, 2003a) sample P-T path metamorphic field gradient 184.2 ± 1.5 Ma W120 (KY) 179.4 ± 1.6 Ma W110 (Sil) W126 (Ky-Sil)

Q: TASK THREE Part A A galaxy is a system of millions or billions of stars, combined with gas and dust,…

A:

Q: Give examples of Step Input, Ramp Input, Rectangular Input. Draw diagrams where necessary

A:

Q: NGC 3379 is an E1 galaxy at a distance of 14.8 Mpc that has an apparent B band magnitude of 10.65…

A: A galaxy is an arrangement of stars, heavenly leftovers, interstellar gas, dust, dim matter, bound…

Q: A closed, rigid tank at 60 Celsius contains only water vapor at a relative humidity of 50% the total…

A:

Q: Describe (be specific for each) what is being done to control this pollutant from the standpoint of…

A: Clean Air Act:  The Clean Air Act provides the legal system of laws and rights that is being used…

Q: What is the main argument for the "Anthropocene" designation given in lecture? World populations…

A: The Anthropocene is a geological unit in Holocene epoch. It is not considered as the geological…

Q: Recall that Ponderosa Pines prefer relatively dry soils. While we may not be surprised to see them…

A: Although Ponderosa Pines prefer comparatively dry soils and meadows prefer moist environment but at…

Q: Prokaryotes were the major life form on Earth for about three Centuries Million years Billion years…

A: The prokaryotes fossils are known from almost 3.5-3.4 billion years of age. These are the cellular…

Q: 4. Discuss in detail Legislative control as an applied method of pest control. Give applicable…

A: Pest management or pest control is a procedure for getting rid of or controlling unwanted animals…

Q: What happened to most of Mars's past atmospheric carbon dioxide? It was lost along with most of the…

A: 15. The correct option is " b ".

Q: Rocks constantly change from one type to another through processes known as the rock cycle. True or…

A:

Q: We observe the sky covering the area with the angular size of 30arcsec X 30arcsec and discover 250…

A: 1)There are 250 universes in 30 arxsec x 30 arcsec estimated region. So essentially, in each rakish…

Q: During the summer months, strong high pressure cells exist off North America's east and west coasts.…

A: High pressure cell and ocean currents are the two factors that responsible for the dry summer season…

Q: Question 1 What is a fluvial process? All processes that involve erosion and deposition. Any process…

A: Answer: option 3. A process that involves rivers or waterways is correct answer. Fluvial processes…

Q: name of that bug?

A: Solution

Q: The _____ mouth anus surrounds the nerve cord in most Chordates. coelom vertebral column

A:

Q: about 2. The following information pertains to the subsurface at a specific location: The soil is…

A: 2. The figure below shows the subdivisions of the cross section according to the given measurements…

Q: View History Bookmarks Profiles Tab Window Help soc a Sinc b Hom C As g de Log CX Mail…

A: Glacial flow are very slow and they get much more friction. The friction is very high in the lower…

Q: 41. Given your understanding of the Hadley circulation and the Coriolis effect, the resultant…

A: Answer: The correct option would be (A) Easterly (from the East).   Explanation: The Hadley…

Q: 2. Consider a parcel of air which reached saturation at a temperature of 3 °C and a pressure of 500…

A: solution

Q: How did we find Uranus? Select the best answer. O Though luck, look for an object that moved…

A: How did we find Uranus? Answer: option 2. Through a large telescope, look for an blue object. In…

Q: 40. Remembering that the Ekman effect is the result of the Coriolis force interacting with the…

A: Answer: The correct answer would be Option (C), water moving out towards the Pacific producing the…

Q: A meteoroid with a mass of 500 kg is hurtling through the Earth's atmosphere at 5,000 m/s. Which of…

A: Here the earth pull on meteoroid will be equal to gravitational force by earth on meteroid  Which…

Q: Speciation is complete when populations look different from one another. True False

A: Answer) Speciation is the process by which two populations of the same species becomes genetically…

Q: A scientist is studying a piece of cloth from an ancient burial site. She dete what is the…

A:

Q: Location headwaters - O coastal plain ) coastal plain size small small large discharge low low high…

A: Q. No. 6 Answer:   Location Size Discharge Chanel property   Headwaters small High narrow…

Q: The correct equation for photosynthesis is: O carbon dioxide + water + sunlight → glucose + oxygen…

A: Photosythesis is the natural process through which green plants make their food. The correct…

Q: List Jared Diamond's 5-points that drive a societal collapse (1. climate change, 2. societal…

A: Jared Diamond is a renowned UCLA professor of geography and physiology. Collapse, his 2005 book,…

Q: decades and centuries, sea level will rise 2 - 10 ft if the Thwaites Glacier collapses. What can…

A: As we all know that Global Warming is the major factor affecting the melting of Glaciers and as…

Q: 4. Based on a seismogram, only one flat interface is expected. (a) Calculate the head waves'…

A: The test statistic is unlikely to lie in regions defined by critical values, such as those where the…

Q: Why did the Ptolemy model have to introduce epicycles into its description of the solar system? O…

A: Option C It was a geocentric model

Q: contrast (i.e. vegetation from water, vegetation from soil, or soil from water)? Visible 1 2 3 NIR…

A: The greatest contrast is found in the increased contrast image as compared to the natural colour…

Q: a) In the Kim Kim river tragedy in Malaysia, please elaborate the chronology and the challenges…

A: As of late, Kim Kim Waterway confronted poisonous contamination episode that happened on 7 Walk 2019…

Q: What causes the rainy and dry seasons in Dakar, Senegal?

A: Dakar, Senegal is located in the west Africa. Its latitudinal position is about 15 degrees north. It…

Q: During the Cretaceous, when the dinosaurs lived, atmospheric CO2 was higher, the climate was warmer…

A: Option C Was higher than today

Q: If Earth were a flat like a plate facing the Sun, all locations would receive sunlight at the same…

A: The flat Earth theory is a scientifically disproven concept of the Earth’s shape as a flat disk or…

Q: What are the two rings in the picture below? G Cengage; NSF/AURA/NOAO Oa. Earth's orbit around the…

A: Note - according to our guidelines we can answer only first question and rest can be reposted.

Q: Correctly arrange the steps that lead to the formation of anthracite. Rank the options below.…

A: Anthracite indicates the final stage of coal formation which possesses very little or no amount of…

Q: Why should acetylated isoforms be avoided in recombinant protein production? Specifically, what is…

A: Acetylation is a modification that can dramatically change the function of a protein through…

Q: See movie 6.2 in the textbook Although originally called 'planets', why were Ceres, Pallas, Juno and…

A: Ans. IAU (International Astronomical Unit) defined the planets and talked about the following…

Q: #2 TACCCCTCTAATGACAGTACT TRANSCRIPTION mRNA: Protein (amino acid sequence): TRANSLATION

A: The RNA TO mRNA follow this sequence A to U. C to G. T to A.

Q: The greenhouse effect describes: a. greenhouse gasses absorbing shortwave radiation and…

A: The Sun is hot so it emits short wave radiation to the Earth. Earth absorbs it at radiate long wave…

Q: In the above image, glacier "B" is best described as: O a valley glacier O a piedmont glacier O a…

A: The Piedmont glacier is one which flows outward from the valley. The valley glacier are only…

Q: which feedback loops played a role in Snowball Earth? select all that are correct O the rock…

A: Regardless of the specific mechanisms responsible for previous glaciations, scientists generally…

Q: 22 Why are asteroids considered pristine. Select the best answer. O They were formed elsewhere and…

A:

Q: How Cirques and Horns glaciers connected?

A: Glaciers are huge, thick and down slope moving bodies of Ice. It moves under the influence of…

Q: Which health outcome is predicted to result from effects of climate change on our environment:…

A: Answer:- Increase in vector-borne disease

Q: Answer the questions: 1.Discuss the influence and relationship of litter composition, temperature,…

A: The decomposition rates for moisture likewise increase as the amount of pore space filled with water…

Q: 3. (iniz) Assume the atmosphere is isothermal at 300 K (very tropical). The surface humidity is 70%.…

A:

Q: could you please include an explanation for a better understanding? 4. a) Draw in isobars at…

A: