Basic characterization of microorganisms found in gochujang.

Q: Write what is meant by the magic bullet.

A: The antimicrobial drug helps in eliminating the pathogenic microorganism from the host body cells…

Q: Name the organism the image represents. And label A and B.

A: The study of tiny creatures such as bacterium, virus, archaea, fungus, and protozoa is known as…

Q: matrix system

A: Introduction:-we can check employees report communication work, where they get to work with…

Q: laboratory

A: For testing a place equipped for experimental study in a science. Analysis a research laboratory…

Q: light on the ranch? mce 16 A. They like to see different colors at night. Selen mine To B. The…

A: There are seven colours and all the different colours in the light spectrum have different…

Q: Present in detail on the Sanger technique

A: Sanger Technique: Sanger sequencing is the process of selective incororation of chain-terminating…

Q: Forensic Science Professor Merrill HANDWRITING COMPARISON Handwriting is often very fluid, ever…

A: Approach to solving the question:  To effectively solve the questions regarding handwriting…

Q: Label the red arrows

A: Introduction: The brain is the primary coordinating center of the body, allowing organisms to think…

Q: can you help me to identify by labelling the slides

A: This is the transverse section of loose areolar connective tissue. The labelled images attached step…

Q: What are the disadvantages of Colestipol?

A: Colestipol is classified as bile acid sequestrant which is prescribed for people with hyperlipidemia…

Q: Recognize the following types of biomolecules when given images such as the ones below and on the…

A: Biomolecules are carbon-containing organic molecules present inside or synthesized within living…

Q: label the parts of the specimen

A: Plant cells are the eukaryotic cells present in green plants. Plants are photosynthetic eukaryotes…

Q: X…

A: Introduction :- Cholesterol is a waxy molecule that can be present in your bloodstream. Cholesterol…

Q: A mutation in the DNA that codes for hemoglobin changes the sequence CTC to CAC. This will cause a…

A: The central dogma of molecular biology posits that information within a living organism flows from…

Q: tate the apparatus used view small samples

A: The world is full of organisms. Organisms have developed from minute single celled structures to…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: 5. What is Bacteriophage typing?

A: Bacteriophages are viruses that target and destroy bacteria. Viruses can be broadly divided into two…

Q: _cells stimulate both arms of the immune response (one arm is self and the other arm is foreign)

A: According to guideliness we have to answer the first question only so please kindly post the 2nd…

Q: Round to 3 Sig Figs. Dilution subject

A: By considering an example the explanation of Dilution calculated to round to 3 significant figures.

Q: lculate the mitotix index from the picture below.

A: Mitosis is a cell division which maintains the chromosome number and divides a cell into two…

Q: Use each of the letters and numbers in the photo to describe the process below

A: Label A represents the Okazaki fragments. Label B represents Helicase. Label C represents DNA…

Q: what is the difference btween NSR and RBBB in details .

A:

Q: Can you help me what the name of the label this picture?

A: Muscles are the largest delicate tissues of the musculoskeletal framework. Muscle is inferred from…

Q: Chapter 5 Improving Flexibility The following are the videos you will need to watch for Chapter 5.…

A: The video is all about stretching and knowledge of muscles. This gives a message that before…

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: Write Cause Effect Essay Topic: Effects of pollution

A: Environmental pollution is at present the greatest challenge that the world is facing today.…

Q: 2 7 3 6 5

A: Introduction: A neuron or nerve cell is a kind of cell that communicates signals and messages to and…

Q: Identify the suffix for process of recording

A: Suffix: It is an affix It is placed after the stem of a word. In medicine it usually indicates: -a…

Q: How many coding professionals are needed in a 60 bed hospital?

A: Medical coding professional is important to provide code for the various procedures that patient has…

Q: what provides an image that is three-dimentional representation with little magnification (two…

A: The question is asking for a tool or device that can provide a three-dimensional image with little…

Q: Slide #3: Radiolarians Distinguishing features: Taxonomic Domain: to Taxonomic Kingdom:

A: 1. DISTINGUISHING FEATURES A. Cell organelles including nucleus are in the endoplasm. b. Ectoplasm…

Q: paragraph paper on the topic of GMO.

A: GENETIC ENGINEERING:- It is a modification in genes that is done using biotechnology ( Recombinant…

Q: Compare the structure, location, and function of DNA and RNA in a chart below

A: DNA is a is normally been described that it's far the molecule this is decided withinside the…

Q: could you please draw this on an A4 paper using dots for the shading

A: This is probably a microorganism in a cullture media. The image can we clearly viewed under a…

Q: Forensic Science Professor Merrill HANDWRITING COMPARISON Handwriting is often very fluid, ever…

A: To analyze the handwriting comparison provided, let's break down the observations and analysis of…

Q: Copyright by SOMSO, 2010, www.somso.com Identify the highlighted structure.

A: the highlighted portion

Q: 00 227

A: The area of the body between the thorax and the pelvis is known as the abdomen. The diaphragm…

Q: ent will h Use DIMENSIONAL ANALYSIS for 11-20 11. Your patient receives Crystodigin 0.1 mg po daily…

A: So, this is the question related to pharmacology. We need to calculate dose to be taken by the…

Q: Of the following, which one uses an across-fiber pattern code? a. Flipping a light switch b. Playing…

A: The term neural coding refers to the study of information processing by neurons. It helps us to…

Q: What is the major target of the anti-inflammatory drug Aspirin (salicylate)?

A: Aspirin is an anti-inflamatory drug that is commonly used for the treatment of reducing pain, fever,…

Q: how would this be drawn if it was inside the image?

A: Independent assortment is the process by which the alleles of two or more different genes get sorted…

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.