b. C. CH3 The e. ܡܐ ܀ d. die 1) Br2, FeBr3 2) Mg 3) CO₂ NaOH Br₂ (excess) N(CH3)2 H $5 H 1. NaOH 2. CH3Br H₂O₂ A NaOEt, EtOH

Q: provide F Etter

A: SN2 mechanism  Inversion take place.

Q: Structures 1-3 are ___. Stabilized by hydrogen bonding The result of protein amino acid sequences…

A: This question is related to amino acid.   Structure 1 is an example of alpha helix. Structure 2 is…

Q: Glucosidase has KM = 6.0 x 10 -5 M; what value of [S] is needed to get: a) v initial = 0.75 V max…

A: Here Michaelis Menten equation will be used whose formula is V0 = vmax [S]/ (Km+S)Here Vo = initial…

Q: H₂N- 010 i CH-C CH₂ 1 CH₂ CH₂ CH₂ NH₂ T₂ A tripeptide consisting of serine, lysine, and…

A: Question 18: Given that, a tripeptide contains serine, lysine and Phenylalanine. We have to identify…

Q: After an electrophoresis experiment, how are the lengths of the DNA fragments in each lane…

A: In electrophoresis experiment is a technique to determine the size of DNA molecules on passing the…

Q: TABLE 2: EFFECT OF TEMPERATURE ON CATALASE ACTIVITY STRENGTH OF REACTION Temperature…

A: The explanation is given below-

Q: tein code shown. On the basis of the enzyme’s structure, its substrate and mechanism of action,…

A: The selective hexokinase 2 inhibitor is Benserazide. It can be typically binds to hexokinase 2 and…

Q: How do promoter catalysts (key word promoter) contribute to environmental sustainability? Remeber to…

A: Promoter catalysts are those that increase the rate of a reaction without themselves getting…

Q: sac ve inhihi. following graph shows the activity versus pH curves for pepsin, sucrase, and trypsin.…

A: Optimum pH is the pH at which the enzyme has maximum activity. Optimum rate is the maximum rate that…

Q: Draw and name the organic product of the given reaction. \(\ce{ {} + HNO3 ->[\large\ce{H2SO4}][]}\)…

A: Benzene and its derivatives undergo electrophilic aromatic substitution reactions when treated with…

Q: What is the greatest barrier to development of fusionreactors?

A: Nuсleаr  fusiоn  is  the  рrосess  in  whiсh  twо  light  nuсlei  соmbine  tо  give  heаvier…

Q: lain what is meant by the term 'resolution' in the above statement?

A:

Q: We have three inhibitor and same enzyme were incubated with 5 mM of substrate and 2 mM of…

A:

Q: Consider the same enzyme catalyzed reaction with KM 25 mM, Vm-100 mM/s, and [S]20 mM. A…

A: Given that  KM is 25 mM Vm is 100 mM/s [S] is 20 mM KI is 10 mM [I] is 5 mM

Q: alculate the Ksp for uraninite (reaction 1) and rutherfordine (reaction 2).             UO2 + 4 H+…

A: UO2+4H+ →U4+  + 2H2O Ksp = U4+Ksp = S Reaction  :1 Ksp  = S

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Calculate ratio of [deprtncted ] of Lysine side chrin at pH 7?

A:

Q: dP AvapH dT T(V, – Vi) AvapH _ AvapH TV, AvapH -P RT2 %3D %3D RT T AvapH For a change of state,…

A: The equation given is,

Q: You analyze the enzyme A's reaction. When vo is 9.6uM s, Vmax is 480uM s and (S) is 40UM, what is…

A:

Q: Metalloprotein linkages are most likely to be formed between: Select one: O a. Two cysteines O b. An…

A: The correct answer is given below

Q: Part A be found in hydrophobic regions Check all that apply. histidine phenylalanine O serine Submit…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Calculate the specificity constant for an enzyme-catalyzed reaction if the total enzyme…

A: Given Etotal =  15 nMVmax  = 9 M/sKm = 150 MSpecificity constant = to be determined

Q: 1/v (mM/min)-¹ -0.1 0.15- 0.10- 0.05- 0.0 0.1 1/[s] mM-1 0.2 he Vmax and Km values for this enzyme…

A: A double reciprocal plot which represents the Michaelis-Menten equation of enzyme kinetics is called…

Q: What is the most anodic protein on electrophoresis at pH 8.6? viilididos ni nasto a. albumin b.…

A: The objective of the question is to find the most anodic protein on electrophoresis at pH  from the…

Q: max represents the rate of reaction for an enzyme-substrate pairing under what conditions? A) when…

A: The maximum velocity of the reaction (Vmax) is attained when the enzyme sites are saturated with…

Q: Draw the structure for the peptide CF. • You do not have to consider stereochemistry. • You do not…

A: Given peptide, CF C- Cysteine F - Phenylalanine

Q: In basic medium which of the following amino acids migrate slower than others towards positive…

A: 1. Amino acids are chemical compounds, made by the attachment of -COOH and -NH2 groups. 2. According…

Q: Ferratin protein contains large amounts of iron, what function might they play? O Transport O…

A: Ferritin is ubiquitous  protein  and  plays  crucial role   and it maintian  adequate supply  of…

Q: 2. Explain why the restriction endonucleases BglII (A^GATCT) and Xbal (T^CTAGA) will not recognize…

A: DNA molecules are cut with the help of restriction enzymes at specific places which helps in…

Q: #lockdown 问题11 Which of the following indicate a beta configuration at the anomeric carbon? 559…

A: Anomeric  are cyclic monosaccharides that are epimer and differ in confirmation at C1 carbon.…

Q: OAc can be used for Sn2 as well  How would this be incorporated into the answer

A: OAc- is a weak nucleophile,  and here solvet is DMSO.

Q: t HO Br CN CN ÅV Br Br 잇 (+/-) MON CN CN CN

A: Step by step each mechanism.

Q: The following data were recorded from an experiment to measure the activity of a peptidase enzyme. A…

A: To determine the maximum velocity (Vmax​) and Michaelis constant (KM​) for an enzyme-catalyzed…

Q: Question 22 Substrate controls should contain residues or remnants of the accelerant or them. O True…

A: The objective of the question is to tell whether the given statement is true or false.

Q: Liquid X is known to have a lower viscosity and lower vapor pressure than Liquid Y. Use these facts…

A: Viscosity is a degree of a fluid's resistance to flow, whereas vapor pressure is a sign of a…

Q: 5. Draw a schematic illustrating the overall iteration process for solid phase peptide synthesis.…

A:

Q: 4. (a) If we have an enzyme solution whose concentration is 1.0 x 10“ M and with a keat value of…

A: We can solve this problem by using the Michaelis-Menten equation  Vo= (Vmax × [S])/(Vm+[S]) Vo =…

Q: 6.) Vmax represents the rate of reaction for an enzyme-substrate pairing under what conditions? B)…

A: Value of Michaelis constant (km) tells about the affinity of enzyme to the substrate.

Q: An enhancer element is a region of ________ and can______ transcription.     A. DNA; activate…

A: we wil choose correct option

Q: Test Analysis Analysis 1 Analysis 2 Analysis 3 Oxidation Lucas Test + + Test Done Lucas Test +;…

A:

Q: Molecule AE is and allosteric effector of an enzyme. In its presence, the curve of enzyme activity…

A: Allosteric effect  is the binding of  one molecules effect the binding of other molecules with…

Q: Enzyme X can act on either substrate A or B; the Km on A Vmax on B.Sketch 1 plot for 1/v vs. 1/[S]…

A: To plot graph for 1v versus 1[S] for the enzyme X in the presence of substrate A and in the presence…

Q: Chemistry help asap! will give you upvote! 7. What is the isoelectric point of the following…

A: #7: Isoelectric point is the average of the two pKa values that are close to each other.

Q: How do you calculate COD Distillate and COD Feed? (Please cite for any tables, book used found for…

A: In the waste water treatment process, reduction of COD is required especially in case of industry…

Q: Allosteric regulation is an example of control loops of biochemical pathways. _______ from…

A:

Solutions

Solutions can be considered as homogeneous mixtures which contain two or more than two chemical substances. The chemical substance which is the greater part is defined as solvent. And the chemical substance that is dissolved in a solvent is referred to as solute. Solution chemistry plays an important role in chemistry since it supports many commercial applications of solutions.