Antiretroviral drugs target various aspects of HIV replication and infection. Which of the following enzymes are targets of antiretroviral drugs? Select ALL that apply a).reverse transcriptase b)integrase c).ligase d).protease e).DNA polymerase
Q: Your friend claims that all mutations are harmful to living things. Do you agree or disagree with…
A: A genetic mutation is a change in the DNA sequence of an organisms genome. Mutations can occur…
Q: What specific part of the cell is RUBISCO found in? matrix of mitochondria stroma of…
A: RUBISCO also known as ribulose 1,5-bisphosphate carboxylase/oxygenase is a critical enzyme in the…
Q: The figure attached represents the structure of a pUC19 plasmid. A 1000 bp fragment was inserted…
A: Plasmids are small, circular DNA molecules that are present in bacteria and are utilised as vectors…
Q: An individual has the following reciprocal translocation: B CDE H B CDE H A J e. What is the name of…
A: When two non-homologous chromosomes exchange their chromosome segments, the resulting chromosomal…
Q: Calculate Eveness index using this data
A: The evenness index is a measure of how evenly distributed the abundance of different species is in a…
Q: The following chromatogram is obtained from the sequencing reaction. Using the key below, what…
A: Saccharomyces cerevisiae or Baker's yeast is used as tool in various genetic experiments. This is…
Q: Based on (MS-LS4-4) standard(grade8) - Mathematical Representations of Natural Selection: Based on…
A: Darwin's finches are a group of closely related bird species that are endemic to the Galapagos…
Q: Give typing answer with explanation and conclusion Which of the following is NOT a direct function…
A: Eukaryotic cells have a network of protein filaments called the cytoskeleton that supports their…
Q: How does genetic expression translate into inherited tendencies for obesity? (citation)
A: Genetic expression refers to the process by which information stored in an individual's genes which…
Q: Describe Human cloning itself – what does it do, how does it work? Relate it to some aspect(s) of…
A: Human cloning is the process of creating a genetically identical copy of an existing human being.…
Q: Is it true or false that the discovery of a classic lymphatic drainage system in the meninges has…
A: In recent years, there has been an increase in study interest in the connection between the gut and…
Q: What risk assessment are involved in yeast experiment
A: There are several risks involved in yeast experiments that should be considered when conducting a…
Q: In regard to the wobble hypothesis and the fact that cells do not need a full complement of tRNAs…
A: The wobble hypothesis, proposed by Francis Crick, describes how the third nucleotide in a codon (in…
Q: 5. Mark whether each of these items stimulates or inhibits the cell cycle: Item Stimulates Inhibits…
A: Oncogenes are mutated forms of normal genes (proto-oncogenes) that promote cell division and…
Q: Extreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response…
A: The SOS response is a DNA damage response mechanism in bacteria that is activated when the cell is…
Q: Give typing answer with explanation and conclusion Negative chemotaxis in migrating neural crest…
A: Neural crest is a group of cells that form along the neural tube during early embryonic development…
Q: After translation, secreted proteins are transported to the cell surface using the Golgi true false
A: Cells are regarded as the smallest level in a living organism. Cell is called the fundamental and…
Q: Select all options below which are correct regarding parasympathetic postganglionic neurons. Their…
A: Parasympathetic postganglionic neurons are a type of neuron in the autonomic nervous system that…
Q: 4. Can you explain why the predator and prey populations do not rise and fall together? What is the…
A: A healthy ecosystem needs predators to function properly. The population of prey is kept in check by…
Q: What is one thing in our modern environment that we are more poorly adapted to than in our…
A: Our sedentary lifestyle is one aspect of our modern world to which we are less well adapted than we…
Q: There is a homeostatic set point for body mass, so that appetite increases when energy expenditures…
A: The homeostatic set point is a concept that refers to the body's tendency to maintain certain…
Q: How does the activity of the sodium-potassium antiport pump contribute to an overall negative…
A: The sodium-potassium antiport pump is a transmembrane protein that is found in the plasma membrane…
Q: Why does inbreeding lead to an increase in recessive deleterious traits (for example inbreeding…
A: Breeding is the process of mating selected individuals of a particular species with desirable traits…
Q: For the species : limentis arthemis provide the following information: 1. Species name/common name…
A: A species is a fundamental classification category used to group individual organisms that share…
Q: Describe the mechanisms by which microtubules assemble.
A: Microtubules are cylindrical structures made up of tubulin protein subunits that are found in…
Q: Match the bold DNA repair response(s) to the triggering type of DNA damage. Homologous…
A: Homologous Recombination: Double-Strand Break repair mechanism which is an accurate repair mechanism…
Q: Broadly name the two types of membrane transporter in the image below (A and B). Give one example of…
A: The cell is surrounded by cell membrane. Communication between the cell and outer world is mediated…
Q: Assume 102 nucleotide pairs of DNA to be responsible for transcription of particular mRNA molecule.…
A: mRNA stands for messenger RNA a type of RNA (ribonucleic acid) molecule that plays a crucial role in…
Q: Question 20. Typically cloning of any DNA fragment involves the following tasks: Put these tasks in…
A: The technique of combining DNA molecules from two separate sources and putting them into a host…
Q: 1. Complete the following chart: CHEMOTHERAPEUTIC AGENT DISK CODE Streptomycin 10 Neomycin…
A: The disk zone inhibition test is the sensitivity test for various bacterial species against specific…
Q: If a prokaryotic gene coding region is 42 nucleotides long, beginning with a start codon and ending…
A: In prokaryotes, such as bacteria, genes consist of a stretch of DNA that codes for a protein. This…
Q: 4. A male rabbit with genotype GgBb x with a female rabbit with genotype ggbb. ● The female only has…
A: A Punnett square is a graphical representation used in genetics to predict the possible genotypes of…
Q: What immune defense would be most impacted for a patient with a C9 complement protein deficiency? Be…
A: The complement system is a complex network of proteins that play a vital role in the immune…
Q: 27) In a single-celled organism, which would you predict to be enclosed within the greatest total…
A: This question is belong to cell- Biology.
Q: What are the consequences of having an odd number of chromosome sets?
A: Chromosomes are long coiled up structures made of DNA and proteins that carry an organisms genetic…
Q: Which of the following statements is NOT true of hormones? O All are organic molecules. All are…
A: A hormone is a chemical messenger produced by specialized cells or glands in the body that regulates…
Q: the effects of cocaine on specific receptors of the brain and how the transmission of action…
A: Cocaine is a tropane alkaloid and secondary metabolite that stimulates the central nervous system…
Q: What is the purpose of adding two drops of acetic acid in thin layer chromatography of plant…
A: Plant pigments are natural substances found in plant cells that give color to different parts of the…
Q: In the two competition study experiments below, what can you say about the relative affinities of…
A: From both the given figures, it can be stated that the relative binding affinity of the labeled…
Q: A patient lacks the ability to make functioning T cells because of a genetic disorder. Would this…
A: Immune system plays an unique role in defence mechanism of our body. Immune system comprises of…
Q: Which of the following is true of the water potential of a healthy living plant cell? ( SELECT ALL…
A: The water potential of a healthy living plant cell is typically determined by the balance between…
Q: A pair of PCR primers is designed to amplify a 2.1 kb genomic fragment of a gene that contains…
A: Polymerase chain reaction (PCR) is a laboratory technique that is used to amplify a segment of DNA…
Q: 17.1 Section Review 1. Classify each organism as either an invertebrate or a vertebrate. a. sponge…
A: Vertebrates and invertebrates are two major groups of animals. Vertebrates are animals that have a…
Q: 5. Drawing upon the results of this exercise, why is Pseudomonas aeruginosa of such concern in burn…
A: Pseudomonas aeruginosa is a common bacterium that poses a significant threat to certain vulnerable…
Q: 1. Suppose a child was found to have the chromosome pattern shown in Figure 1 above. a. Is the child…
A: Karyotype is a total collection of the chromosomes of a organism. For suppose the karytope of humans…
Q: Question 2 Glomerular (Bowman's) capsule and the glomerulus make up the O renal pyramid. O nephron…
A: The glomerulus is a tiny ball-shaped network of capillaries located in the renal corpuscle of the…
Q: What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…
A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…
Q: The term phylloxera refers to an insect which destroyed French vines around 1900. a variety of…
A: Photosynthesis is a biological process that occurs in algae, plants, and certain bacteria, by which…
Q: An amino acid mutation in the voltage-gated sodium channel that caused the voltage gate helices to…
A: Amino acids are organic compounds that are the building blocks of proteins. They contain an amino…
Q: Which of the following is an example of a post-translational modification? Select an answer and…
A: Post-translational modifications (PTMs) are chemical modifications that occur on a protein after it…
Antiretroviral drugs target various aspects of HIV replication and infection. Which of the following enzymes are targets of antiretroviral drugs? Select ALL that apply
a).reverse transcriptase
b)integrase
c).ligase
d).protease
e).DNA polymerase
Step by step
Solved in 3 steps
- Which antiretroviral drug class does Zidovudine (AZT) belong to? a) Non-nucleoside reverse transcriptase inhibitors (NNRTIs) b) Nucleoside reverse transcriptase inhibitors (NRTIs) c) Protease inhibitors d) Integrase inhibitorsDecreasing the amount of cytokine produced by the body would most directly prevent what event during the progression of COVID-19 in its host? A). Early viral infection of host cells. B). Replication of infected cells. C). Excessive damage to lung cells by the hot immune system. D). Transmission of the virus from one host to another.n the "Vaccine Strategies" figure, multiple vaccination options are presented. Select all options below which are options under consideration for the COVID-19 vaccine. A). Injection of a weakened virus B). Injection of an inactive virus. C). Injection of a related coronavirus. D). Injection of genetic material to produce viral proteins directly in the cell.
- What is the action mechanism of the antiretroviral drugs called protease inhibitors which are used against HIV infection?Identify examples of cell-wall antibiotics that are not beta-lactam drugs.a. Which type of viruses can be directly used for translation? a) dsRNA b) Positive ssRNA c) Retroviruses d) Negative ssRNA b. An antiviral drug specifically modifies viral receptors on a eukaryotic host cell. How might this affect the viral reproductive cycle? It would enhance the process of viral apoptosis It would result in the degeneration of the viral capsid It would facilitate the process of viral endocytosis It would prevent the virus from attaching to the host cell
- The major issue associated with the use of live, attenuated virus for vaccines is _____. A) reversion to virulent strain that causes disease B) ineffectiveness because it’s not “the real thing” C) contamination with other viruses or bacteria D) the capacity to induce shock in recipientsWhich of the following statement is false regarding the SARS-CoV-2 protease Mpro? a) Mpro catalyze the translation of viral RNA into polyproteins b) Mpro is an ideal drug target because its structure is largely conserved across the SARS-CoV family c) N3 is an irreversible inhibitor that block the substrate binding site of Mpro d) Mpro forms a dimeric structure and each protomer is composed of three domainsAside from antibody-producing vaccines against spike proteins, describe at least 2 other therapeutic strategies that employ knowledge of pathways allowing viral entry into cells and/or mechanisms preventing replication of new viral particles after entry.