Answer the ff. questions: 1. What factors influence the metabolic rate of citrate in the mitochondria? 2. What is the fate of cytosolic pyruvate when it is reduced by cytosolic NADH? 3. Could leptin be used to treat obesity?
Q: Why is DNA not RNA the storage for genetic information?
A: DNA : Deoxyribonucleic acid is a genetic material for the storage of information. The structure of…
Q: Consider 41 NADH and 19 FADH, molecules funneling electrons into the electron transport chain…
A: Oxidative phosphorylation is the end point of energy-yielding metabolism in aerobic organisms. It…
Q: Prepare a concept map connecting carbohydrate and lipid synthesis. Your map should include shared…
A: Carbohydrate metabolism : Carbohydrates are the most abundant molecule defined as a poly hydroxy…
Q: Aldolase is a key enzyme in glycolysis that catalyzes the cleavage of its substrate,…
A: During glycolysis, Aldolase catalyzes the cleavage of its substrate fructose-1,6-bisphosphate into…
Q: Multiple forms of enzymes with the same catalytic activity but with different structures are called:…
A: Option (a) is incorrect because Holoenzyme:- The complete, biologically active conjugated enzyme (…
Q: D. Lactate
A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…
Q: topic: gel electrophoresis What is the purpose of the running buffer?
A: The gel electrophoresis is a biochemical technique, which helps to separate the proteins and DNA,…
Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…
A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…
Q: What are the diseases a-ketoglutarate dehydrogenase deficiency, succinate dehydrogenase deficiency,…
A: ketoglutarate dehydrogenase: This is the enzyme that catalyses the conversion of alpha keto…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: An antagonist is a particular drug that blocks opioids by attaching to the specific opioid receptors…
Q: Calculate the overall ΔG° (report up to two decimal places) for the net reaction (see attached…
A: Standard free energy change is the Gibb's free energy at 273k temperature and 1 atm pressure ∆G°=…
Q: According to the search results from question 7, which of the following lipids is (currently) only…
A: Human body contains many sialic acid containing gangliosides or glycosphingolipids such as GM1,…
Q: dehydrogenase, which converts pyruvate to lactate in the presence of NADH. The velocity of the…
A: Kcat is also known as catalytic constant or turnover number. It can be defined as the amount of…
Q: HomeExpert Q&AMy answers How is serine related to the activated methyl cycle? Serine’s side chain…
A: Serine is a non-essential amino acid. It is a glucogenic amino acid. Serine undergoes deamination…
Q: Is proteus vulgaris positive or negative in lia test? Why?
A: Proteus vulgaris is a gram negative bacteria that test positive for indole and catalase production.…
Q: Which peptide will yield the following qualitative resul Millon's Test (+) Fohl's Test (+) Sakaguchi…
A: Introduction: Amino acids are the building block of proteins and are linked to a peptide bond. Each…
Q: Amino acids with non-polar side chains are zwitterions at a. middle pH levels, between the pKa’s of…
A: Amino acids are compounds with an amino group, a carboxyl group, a hydrogen atom, and a variable…
Q: Step by Step process of Embden-Meyerhof pathway of RBC metabolism Pls Explain as simple as…
A:
Q: Why is understanding reaction rates significant? Indicate at least 3 key importance of understanding…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: Sample Observation Remarks Albumin A Casein B Glycine C Tyrosine D
A: Ninhydrin test: This is a specific test for the identification of Amino acids, ammonia, primary /…
Q: Write the metabolism (phase 1 & phase 2) of Phenoxybenzamin
A: Phenoxybenzamine is an alpha-adrenergic antagonist with long duration of action because of longer…
Q: The laboratory requests of the physician are Glycosylated Hemoglobin and Serum Glucose for Mr. John…
A: Introduction: Glycosylated hemoglobin is a form of hemoglobin that is measured primarily to monitor…
Q: 1. In one (1) sentence point out a key structural similarity and difference in each of the following…
A: There are 4 Biomacromolecules . They are carbohydrates, proteins , lipids and nucleic acids. Each of…
Q: How many cycles of β oxidation are necessary to completely catabolize palmitic acid ( CH3(CH2)14COOH…
A: Introduction: Fats are important sources of energy for our body as 1g of fat gives 9kcal of energy.…
Q: In which of the following pairs Is the first eleme than the second? (1 Point) O 0, P O Cs, Rb O I,…
A: Electronegativity - It is property of an atom in a molecule. The tendency of an atom to attract the…
Q: a) Lock and key model versus induced fit model of enzyme activity. (b) Competitive and…
A: Introduction: All the biochemical reactions are enzymes catalyzed in a living organism. Enzymes are…
Q: Roam around your kitchen and collect some items that you can categorize as sources of each…
A: Carbohydrates are one of the important nutrient. Its major functions as a energy source, and also…
Q: Feedback See Periodic Table Which of the following correctly describe both a lectin and a…
A: Lectins are stated as either the proteins or the glycoproteins that are present in almost all…
Q: rue or False? a. Ribose and deoxyribose are formed from glucose.
A: Ribose is a pentose sugar with molecular formula C₅H₁₀O₅, it is the prime component of…
Q: Enzymes act by: a. increasing the activation energy for a reaction b. lowering the activation energy…
A: An enzyme has the ability to attract the substrate to the active site which further results in the…
Q: hat are the components of Water? Explain and show some illustration
A: Introduction: For the existence of all living things, water is very essential. Without water, one…
Q: hosphate buffers are commonly used to mimic biological systems. Given that phosophoric acid is a…
A: Phosphate Buffer System consists or made up of:- Sodium Dihydrogen Phosphate & Disodium…
Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…
A: Two answers are correct
Q: What is the difference between the two salt precipitation methods: salting in and salting out?…
A: The solubility of a protein in solution depends on the concentration of the salt present in…
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA
A: Polyadenylation signal sequence :- is the signal sequence needed to add poly A tail at 3' end of…
Q: The Human genome project used the following methods Shotgun Sanger Both None
A: The Human Genome Project : It was an international effort to find the DNA sequence of the complete…
Q: What type of control generally involves binding of a repressor protein to a regulatory DNA sequence?…
A: Repressor : DNA binding protein which inhibits the expression of 1 or more genes via the binding to…
Q: 1. Calculate the overall AG°' (reported up to two decimal places) for the net reaction. kJ/mol 2.…
A: In biological systems, a thermodynamically unfavorable reaction with a positive Delta G value is…
Q: the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle? What…
A: TCA / Krebs cycle : An ingenious series of reaction catalyzes by eight different enzyme that…
Q: In the RBCs of the patient described in the picture, which of the following would be expected?…
A: Glycolysis occurs in both aerobic as well as anaerobic respiration. Glycolysis is the only…
Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False
A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…
Q: TRNA and 5S RNA genes both have the following internal control region. BoxA BoxB BoxC
A: An internal control region is determines as a sequence that is made up of DNA and is located only…
Q: (Q39) A mutation in a certain protein results in the presence of a cysteine residue (rather than the…
A: A mutation is considered as a change in a DNA sequence. Mutations can easily result from specific…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Determine whether the following monosaccharides have D or L configuration and classify them based on…
A: In the d/l system (named after Latin dexter and laevus) molecules are named relating them to the…
Q: gel electrophoresis
A: Gel Electrophoresis is a simple , rapid and analytical technique which is used for separating the…
Q: Which among the following The colored solution formed as a positive result for the Biuret test is…
A: A polypeptide chain has amino acids linked together by a peptide backbone.
Q: Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? • What happens to…
A: The gastric juice comprises of water, mucus, hydrochloric acid, pepsin, and intrinsic factor and…
Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- b. High concentration of NADPH increases the rate of the pentose phosphate pathway by stimulating glucose-6-phosphate dehydrogenase. i. True ii. FalseMatch the appropriate terms to their definitions TCA cycle or tricarboxylic acid Choose.. cycle Choose. aerobic the pathway in which glucose is metabolized to lactate in the muscle, lactate is converted back to glucose in the liver, and then glucose is returned to the muscle the making of glucose from a noncarbohydrate source such as amino acids or glycerol requiring oxygen anaerobic the metabolic breakdown of glucose to pyruvate not requiring oxygen. a series of metabolic reactions that break down molecules of acetyl CoA to carbon dioxide and hydrogen atoms Cori cycle Choose.. glycolysis Choose... gluconeogenesis Choose...5:42 * 0 00 ..l *491| 35% O Activity No. 2... Activity No. 2.4 Glycolysis (Week 2) Name: Section: Directions: Fill in the blanks for the questions related to the glycolytic pathway. Glucose АТР Step 1. -1 ATP ADP Glucose-6-phosphate Step 2. Fructose-6-phosphate ATP -1 ATP Step 3. PFK ADP Fructose-1,6-bisphosphate Step 4. DHAP G3P Step 5. GẶP NAD' GŽP NAD NADH+H Pi Pi- Step 6. NADH+H° Questions: 1. Which two reactions of glycolysis requires an investment of ATP energy, and which enzyme catalyzes each reactiomn? Step No. Enyzme Step No. Enzyme 2. Which two reactions of glycolysis generate energy in the form of ATP, and which enzyme catalyzes each reaction?
- Answer the following questions below: 1. Individuals with a thiamine-deficient diet have relatively high levels of pyruvate in their blood. Explain in biochemical terms. 2. How would a riboflavin deficiency affect the functioning of the citric acid cycle? Explain your answer.Describe the role of ethanol in cellular energy supply, the metabolism of ethanol (alcohol), the regulation of its metabolism and the disease conditions associated with its metabolism especially - hypoglycemia, ketoacidosis, hepatic steatosis, Vitamin deficiency, and acetaldehyde toxicity (you should feel free to discuss other diseases that are directly related to ethanol metabolism).A. What would happen in the Krebs cycle with the loss of activity of phosphoglycerate kinase? What would happen in glycolysis? 10. What happens to glycolysis with the addition of high amounts of citrate? What happens to ETS? 11. What happens in the Krebs cycle with a block in fumerase? 12.If an amino acid enters the Krebs cycle at the acetyl CoA entry point, how much more ATP is being made than if it enters at a keto-glutarate?
- Indicate what will happen (increase, decrease or no effect) to the activity of enzyme or rate of the metabolic pathway given the following conditions: 1. release of glucagon in the blood to the activity of carnitine acyl transferase 1 2. phosphorylation of acetyl CoA carboxylase 3. low [carbon dioxide]/[oxygen gas] ratio to the oxygenase activity of RuBisCOPlease answer as many as possible 1. Substrate regulation of glycolysis and citric acid cycle (fructose-2,6-bisphosphate, fructose-1,6-bisphosphate, ADP, AMP-positive effectors of glycolysis enzymes; ATP, citrate, NADH, acetyl-CoA-negative effectors of glycolysis enzymes; ADP, AMP-positive effectors of citric acid cycle enzymes; ATP, NADH-negative effectors of citric acid cycle enzymes). 2. The role of the liver in the regulation of glucose concentration. 3. Hormonal regulation of glucose metabolism (the influence of epinephrine, glucagon, glucocorticoids, ACTH, STH, the central role of insulin in regulation of glucose metabolism). 4. Peculiarities of carbohydrate metabolism in the liver and muscles. 5. Peculiarities of carbohydrate metabolism in tumor cells.A. Identify different types of organic reaction mechanims in the followingmetabolic pathways.1. Catabolism of triacylglycerols- beta-oxidation pathway2. Biosynthesis of fatty acids from Acetyl CoA3. Glycolysis (from glucose to two molecules of pyruvate)4. Conversion of Pyruvate to Acetyl CoA5.Citric acid cycle6. Gluconeogensis pathway (pyruvate to glucose) B. Identify at most 5 organic reactions for each metabolic pathway.
- Study Figure 19.18 and decide which of the following statements is false. Pyruvate dehydrogenase is inhibited by· NIADH. Pyruvate dehydrogenase is inhibited by AΤΡ. Citrate synthase is inhibited by NADH. Succinyl-CoA activates citrate synthase. Acetyl-CoA activates pyruvate carboxylase.Indicate whether the following sentences is True or False ? 1. The lactate plasma levels are usually lower than pyruvate levelsIn 3-4 sentences, briefly explain how lactate is formed, the biological effect of lactate, and explain the biochemical process and path for conversion of lactate. 3. The hormones glucagon, epinephrine, and insulin, can regulate blood glucose levels to protect the brain. For each one provide a short explanation as to whether it raises or lowers glucose how it does this, and indicate whether it is metabolic or catabolic.