Analyze the fly wing (left) and the bird wing (right). Are these structures homologous or analogous? Humeral win Costa Subcosta Ahila Anal cell Basal cells Discal cell Posterior cross- vein Analogous Anterior cross veln O Homologous Ulna un Humerus Radius Metacarpals Phalanges

Q: Why do red blood cells swell up and burst when placed in pure water?

A: A red blood cell will swell and undergo hemolysis.

Q: How is hemolytic anemia related to pentose phosphate?

A: Introduction: It is anemia due to hemolysis of red blood cells that occurs either in the blood…

Q: Define Casparian strip

A: Morphology is the branch of science that studies the structure, characteristics, and form of…

Q: objects that are moving are said to poses ___________energy

A: Energy is the strength that is required for performing both the physical and mental activity.

Q: On the basis of the appearance of this plate, what are you testing for? Describe the reactions at A,…

A: The disc diffusion methodology (DDM) is an agar diffusion method (ADM) because the plant extract to…

Q: Which are the two forces that make up the electrochemical?

A: The active transport of ions across the cell membrane causes an electrical gradient to build across…

Q: What does Laplace’s law show?

A: The law of Laplace was discovered by a team of mathematicians including  Piere-Simon Laplace. The…

Q: What are Starling Forces?

A: STARLING (1894, 1896) described the basic forces responsible for producing fluid shifts between the…

Q: Why was an oxonium ion expected to be involved in the lysozyme reaction?

A: Lysozyme is a naturally occurring enzyme which is found in bodily secretions such as tears, saliva,…

Q: Define Bohr effect

A: In human physiology, the Bohr effect refers to the phenomenon that describes hemoglobin's function.…

Q: dioxide (CO,). The equation below shows this reaction. CACO, → CaO + CO, Reactant Products In this…

A: This question can be solved on the basis of law of conservation of mass which says that energy or…

Q: Summarize the significance of the Griffith and Averyexperiments.

A: Significance of the Griffith and Avery experiments are;-

Q: Determine the following equivalents: (Round to the nearest tenth on weight 6.8 oz = 7.2 tsp = 8. 45…

A: To convert one unit to another, we must find the value of unit in comparison to 1 of the second…

Q: What is 10% law?

A: 10% energy transfer law in the food chain is put forth by Lindeman. A pyramid of energy depicts the…

Q: How many moles of tungsten(VI) oxide and hydrogen were required to produce the 5.00 g of tungsten?

A: Stoichiometry is a section of chemistry that involves using relationships between reactants and/or…

Q: What are some risks associated with long term exposure to radiation

A: Exposure to very high levels of radiation, such as being close to an atomic blast, can cause acute…

Q: What is a Spectrogram

A: Spectrogram is a visual way of viewing the spectrum of frequencies of signal that varies with time.

Q: 1 1/2 oz = ? mL

A: Matters can be in three different states. These are liquid, solid, and gas.  For measuring each…

Q: What is diluted acid

A: Acids are compounds containing hydrogen that can be replaced by a metal. Acid dissolve in water to…

Q: You have a stock vial of diclofenac (75 mg in 3 mL) and need to draw up a dose of 50 mg for your…

A: Given:Stock vial of diclofenac: 75 mg in 3 mLDesired dose: 50 mgTo find:mLs should be drawn up to…

Q: So the answer is 75cm?

A: The complementation observed between the C and d mutants indicates that they affect different genes…

Q: what are the biological effects of ionising radiation

A: Ionizing radiations are the radiations which carries higher energy and these radiations  are able to…

Q: What is the order of magnitude of 0,0076

A: Introduction The order of magnitude of a number is the smallest power of 10 used to represent that…

Q: why steroids do not show luminescence on thin layer chromatographic plates?

A: Infrared absorption spectroscopy also stated as IR spectroscopy is one of the most valuable…

Q: Approximately what amount (in Sv) of short-term exposure to radiation produces noticeable effects in…

A: Uptake of a high level of radiation over a short time may cause symptoms related to radiation…

Q: Calculez: 0.02cm+3.72mm+0.024m+230µm. Give the answer in mm (do not round off your answer, write…

A: A micrometer, often called a micron, is a unit of length in the metric system, symbolized as µm. It…

Q: From which substance morphine derived ?

A: Morphine is a highly addictive painkiller that is isolated from the opium poppy.

Q: What is the volume (in mL) of ethanol in the bottle?

A: Volume is calculated by the % by volume formula, that is volume of solute dissolved in the volume of…

Q: What glycolytic enzyme appears to be impaired?

A: Glycolysis is the pathway in which glucose molecules are broken down to pyruvate. During this…

Q: Calculate the Redlich-Kwong parameters of fluorine from the values of the critical constants

A: a = R2Tc5/29Pc(21/3-1)              For , fluorine…

Q: Explain the RAAS mechanism. ?

A: The RAAS is a complicated multi-organ endocrine (hormone) system that controls vascular resistance…

Q: What is the function of the neutralization solution?

A: DNA Neutralizing Solution is utilized for the disengagement (isolation) of plasmid DNA by soluble…

Q: what is a wine bottle?

A: Wine is typically a fermented grape-based alcoholic beverage. The sugar in the grapes is consumed by…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: Name the class.

A: Arthropoda is the largest animal phylum, which includes the insects. These animals are constituted…

Q: What is the trade name of Duloxetine?

A: Trade name : Brand/trademark name  Asked : Trade name of Duloxetine

Q: What is ethidium bromide ?

A: Agarose gel electrophoresis is commonly used for the separation of nucleic acid molecules. It…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.