An immersion lens was used to examine the microorganisms microscopically in a light microscope. ANSWER THE QUESTIONS 1. What symbols can be used to identify an immersion lens? What is the immersion system? Why is it necessary to use an immersion lens to study microorganisms? 2. 3.
Q: Part 1: Explain the term 'negative feedback', and use the example of blood glucose homeostasis to…
A: Negative feedback loops are frequently involved in homeostasis maintenance. The stimulus or cue that…
Q: Joe went to the emergency room, where he complained of severe pains in the lower right quadrant of…
A: Imaging techniques play a crucial role in the diagnostic process for many medical conditions. These…
Q: Adipose tissue under microscope labeled diagram with magnification calculations
A: Adipose tissues are basically fat-storing cells of the body that help in energy homeostasis. These…
Q: Describe some strategies that could be implemented to reduce the transmission of giardiasis.
A: Giardiasis is a protozoan disease caused by the microscopic parasite Giardia duodenalis. Giardia is…
Q: Does the atmospheric CO2 level stay the same throughout the year or does it change throughout the…
A: Atmospheric CO2 level majorly depends on the photosynthesis process of plants.
Q: How do you make a 10x solution of 1M dextrose? What should be the volume and how many grams.
A: Dextrose is a simple sugar with the same molecular formula as glucose. It is frequently used as a…
Q: Genetic and genomic research can have social and environmental implications.
A: Genetic modifications do have environmental implications which can be observed from the given graph.…
Q: Which type of mechanism best repairs thymidine dimers caused by exposure to UV light? a. Nucleotide…
A: INTRODUCTION Thymidine Dimers: Cyclobutane thymine dimer, a photo lesson caused by sunlight's UV…
Q: 0 НО-Р-О-Р-О- ОН ОН ОН NH₂ N N
A: E
Q: Palivizumab is a humanized monoclonal anitbody for the prohylaxis of resporatory diseases caused by…
A: The virus is the submicroscopic infectious agent which infect the host cells like plant, animal or…
Q: Explain the paradox implicit in Bruce McEwen's "allostatic load" concept. How is the concept useful…
A: The allostatic load concept was given by McEwen and Stellar in 1993. According to McEwen and…
Q: Evolution is biology's 's core theme that ties together all the other themes. This is because…
A: 1.) According to the RNA world hypothesis life on earth began with a simple RNA molecule that could…
Q: Name the three connective tissue sheaths that surround a peripheral nerve. Which of these coverings…
A: Neuroregeneration: The regrowth or repair of neural tissues, cells, or cell products is referred to…
Q: 1. As DNA engages in semi-conservative replication, explain what the following enzymes roles are in…
A: The process of replication follows a semi-conservative model and approach. In this process, DNA…
Q: Which of the following is associated with only the lagging strand during DNA replication? a. RNA…
A: DNA is double stranded which is translated into RNA which then transcribed to form proteins.
Q: List the steps involved in neurotransmitter release starting with depolarization and ending with…
A: Neurotransmitter release is the process by which a neuron releases chemical messengers called…
Q: Which of the following statements is true about NHEJ (Non-Homologous End Joining) repair? a. This is…
A: Non-homologous end joining(NHEJ) is basically a repair pathway.It mainly repairs double-strand…
Q: 6. Why is DNA replication considered to be semiconservative? a. Each original DNA strands makes a…
A: DNA replication is a process where a double-stranded DNA molecule is copied to produce two identical…
Q: 14. What is an anticodon? a. The three tRNA bases that pair with a specific amino acid. b. The three…
A: What is anticodon? Option b. The three tRNA bases that pair with a specific codon in an mRNA.
Q: How many amino acids are in KMT2D peptide sequence?
A: Introduction Organic substances known as amino acids have both functional groups for amino and…
Q: Describe the major identifying characteristics of Giardia lamblia (intestinalis), including a…
A: Protists are unicellular eukaryotes. These are phototrophic or heterotrophic microbes that are…
Q: 6. What are carbohydrates? * O Different combinations of amino acids O Lipid monomers held together…
A: Macromolecules are large, complex molecules that are essential to the structure and function of all…
Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…
A: First let's try to understand these terms clearly:
Q: Transcription start site selection by S. cerevisiae Pol II occurs over a range of positions located…
A: Introduction: Transcription start sites (TSSs) are acquired by RNA polymerase II (Pol II) in…
Q: A cell in G1 of interphase has 8 chromosomes. How many chromosomes, and how many DNA molecules will…
A: A cell's growth and division are accompanied by a sequence of processes known as a cell cycle. A…
Q: Consider three yellow, round peas, labeled A, B, and C. Each was grown into a plant and crossed to a…
A: Introduction A gene exists in two alternative forms called alleles. If both the alleles are same, it…
Q: Unambiguous Nonoverlapping ○ Universal 4. The promoter region contains a consensus sequence where…
A: The promoter region is a specific DNA sequence located upstream of a gene that is responsible for…
Q: Compare and Contrast a Chlorophyll lacking plant
A: Chlorophyll-lacking plants and fungi are both organisms that lack the essential green pigment…
Q: 2. In Glycolysis, glucose is broken down into 2 pyruvate molecules, how many ATP are needed to…
A: Glycolysis is the process that helps to produce pyruvate from glucose. This process is much needed…
Q: a. State the sizes of restriction fragments that would be generated by each of the following…
A: The sizes of restriction fragments that would be generated by following restriction digestions of…
Q: Imagine you are a student in Alfred Hershey and Martha Chase's lab in the late 1940s. You are given…
A: Hershey and Chase experiment was just like a milestone in the history of genetics.By this experiment…
Q: Why are defects in DNA repair often associated with cancer?
A: Cancer is mainly a genetical disease.It can directly affect DNA of our cells.Now to form a cancer…
Q: creb can facilitate the opening of the chromatin structure by removing which enzyme? 1. HAT 2.…
A: The lysine residues of the nucleosomes are altered epigenetically through histone acetylation. The…
Q: Can you Describe in 1500 words, Planning Cycle for a Health Program?
A: Health program basically means to provide basic preventive ideas to prevent the spread of…
Q: 98. Which of these could cause hemolytic anemia? A. Genetics B. Snake venom C. Chemotherapy drugs D.…
A: Anemia caused by excessive hemolysis happens when there are not enough RBCs in the body. Hemolysis…
Q: How is the correct bacterial symbiont selected in the squid–Aliivibrio symbiosis?
A: Squid rely on Allivibrio bacteria to produce light, which helps them to mix in with light from…
Q: which of these is a/arepossible treatment option(s) for the disease(s) caused by mutations within…
A: A. Surgery - Surgery is a procedure that involves cutting of a patient's tissues or closure of a…
Q: For #2 through #4, calculate the following and fill in the answers in the table below. 2. Add 2500ml…
A: Units are used to refer to a specific physical quantity of a substance or object such as its weight,…
Q: Suppose that goats have one gene that codes for color, where A is brown and a is white. The goats…
A: The alleles that an individual carries are inherited from each parent. The dominant…
Q: transmission of pain from the periphery of the body to its perception in the brain.
A:
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: 4. Who covers the cost of genetic testing? Is this approved by most insurance carriers? If the test…
A: Genetic testing is a type of medical test that examines an individual's DNA, the genetic material…
Q: Which of the following are reproductive organs? Select all that apply A. Root B. Leaf C. Stem…
A: In plants, which organs are directly responsible for sexual reproduction, or take part in sexual…
Q: 5c. What causes the CO2 level in the atmosphere to decrease in the summer months in the northern…
A: Photosynthesis is the most important process which decides the levels of carbon dioxide in the…
Q: 8. Evolutionary biologists can estimate when major clades probably diverged from each other using…
A: Clade analysis can aid in conservation biology. By understanding the evolutionary history and…
Q: Trace the events from copulation to zygote formation in a human female.
A: Introduction: A gamete joining is referred to as fertilisation. Sperm and egg combine during…
Q: Name at least two diseases that have been eradicated due to immunization.
A: Certain diseases can be fatal and highly severe. Since of how quickly they spread, it is important…
Q: Black coffee has pH levels as low as 5. Lemon juice has a pH of 2. This means that the lemon juice…
A: The pH scale ranges from 0 to 14, with a pH of 7 being neutral. A pH less than 7 is considered…
Q: What advantages are there to using plant associated microorganisms rather than animal associated…
A: Microorganisms are essential because they play a role in many ecosystem functioning, such as…
Q: The identity of Kim's biological father is unknown, but it is thought to be either Kevin or Thomas.…
A: DNA fingerprinting is a method of identifying an individual based on their unique DNA pattern. It…
Step by step
Solved in 2 steps
- Answer the following questions: 1. Why do we pass the smear in the open flame of the bunsen burner 3 times? What do we want to achieve by doing this? 2. Is the size of the bacterial smear on the slide very critical to the analysis? Why or why not? 3. Is the thickness of the bacterial smear on the slide very critical to the analysis? Why or why not? 4. Why do we pass the smear in a gentle stream of water after flooding it with a stain? What do we want to prevent by doing this? 5. Is the duration or time of stain application very critical in simple staining? Why or why not? NOTE: Please try to answer all of the questions asked, i promise to give you a good ratings66671/take/questions/800382 Regarding Gram staining, what will be the appearance of the Gram-negative bacteria if... All steps are done correctly? [Choose ] [Choose ] Pink The slide is not heat-fixed prior to Purple staining? Clear Orange Crystal violet was omitted? lodine was omitted? Only iodine was used? Acetone:alcohol was omitted? Too much acetone:alcohol was used or was left on for too long? Not enough acetone:alcohol was used? Carbol fuschin was omitted? Carbol fuschin or safranin was omitted? [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ]Answer these questions by watching the YouTube videos and reviewing the Powerpoints from Lab #4. 1. What is Refraction of light? 2. What is the difference between the Ocular lens and the Objective lens? 3. What is the purpose of the Revolving Nosepiece? 4. What is the difference between the Course Adjustment Knob and the Fine Adjustment Knob? 5. How do you calculate Total Magnification? 6. What is Resolution in terms of Microscopy? 7. What is the purpose of Oil Immersion? 8. What is the Diffraction Barrier and why does it exist? 9. What is the purpose of using stains and fluorescent dyes in microscopy? 10. What is the advantage of using an Electron Microscope? 11. What Objective lens should you always start with? 12. What is the purpose of the Iris Diaphragm on the Condenser? 13. How do you know your Objective lens has been adjusted properly? 14. Why should you not use Kimwipes…
- Write T (True) or F (False) for the following statements. 1. The objective lens is the one nearest to the observer's eye. 2. Only special lens paper should be used to clean the objectives, oculars, and the condenser of the microscope. 3. The working distance is the distance between the specimen and the objective lens. _4. Magnifying a blurred image generally reveals further details. 5. When a microscope is parfocal, you should not have to use the coarse adjustment at higher magnification. _6. The total magnification of the object seen at high dry power is approximately 40X. 7. Immersion oil can be used to increase resolution of all the objective lenses in a brightfield microscope. _8. Always be sure to oil your microscope lenses before returning the instrument to its designated space. 9. Animals will not survive without mitochondria because they will not be able to make ATP. 10. The use of normal saline solution (NSS) in viewing cheek cells is to prevent lysis or crenation of cells.Identify: 1. Cell shape and arrangement in A? 2. Gram stain reaction in A? 3. Cell shape and arrangement in B? 4. Gram stain reaction in B? 5. Genus and species of B? (component of the normal flora of the skin)Match the expected result (purple, red, or colorless) to the following descriptions of Gram-stained cells.Consult your chart at the beginning of this lab report if you need help remembering the correct Gramreaction for each species. Choices may be used more than once. Staphylococcus aureus before the primary stain
- Please include your reference below for my further research. Thank you! 1. What are the basic components of a Fluorescence Microscope and what are the functions of each? 2. Are there any parts that you can remove without compromising accuracy and utility of the equipment? 3. Can you suggest additional components to improve the equipment?izzes/00071/take/questions/600381 Regarding Gram staining, what will be the appearance of the Gram-positive bacteria if... All steps are done correctly? The slide is not heat-fixed prior to staining? Crystal violet was omitted? lodine was omitted? Only iodine was used? Acetone:alcohol was omitted? Too much acetone:alcohol was used or was left on for too long? I Not enough acetone:alcohol was used? Carbol fuschin or safranin was omitted? W [Choose ] [Choose ] Purple Clear Pink Orange [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] 88 22°CPlease write, in paragraph form, how you would identify the organism step by step. Remember to provide as much detail as possible, including but not limited to staining procedures, identification methods and their results. You have been given the final answer (type of organism), now explain to me in detail how you would come to this conclusion Type of organism Topic is : Proteus vulgaris
- blackboardcdn.com/5bfc08ba3fldc/14683296?X-Blackboard-Expiration=16245468000008X-Blackboard- 19 / 47 100% 1.4. Functions of the light mlcroscope parts Complete the following table by writing the function(s) of each of the parts indicated. Structure Function Diaphragm / iris Stage opehing Lamp Objective lenses Eye piece Coarse and find adjustment knobs Stage Stage rack prt sc delete home backspace lock enter pause t shiftChoose the one answer that fits best. Which of the following statements regarding the proper procedure for using Micropipettes is NOT correct? O a. You cannot use a 2-20 µl micropipette to pipet 200 µl O b. To expel all the liquid from the tip, you have to press the eject button O c. To draw up solution, press and hold the plunger at the first stop before entering the solution O d. Micropipettes always require the use of a disposable plastic tip O e. While pipetting, micropipettes should always be held as straight as possiblea. How was the specimen prepared for the microscopy technique applied? (for e.g. stained with H&E stain, Gram stain, unstained) b. What is the microscopy technique and magnification used to obtain this image? c. What is the basic principle of image formation using this microscopy technique? d. What can be observed and concluded from the image of the specimen? e. Are there any potential aberrations present in this specimen image? Describe these and how they may affect interpretation of the result.