Amino acids and roteins - Diseuss Write a detailed eassy on the above topic.Please give hand written answer. re write in a good handwr nut margins o

Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…

A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…

Q: Amino acids link through the carboxyl to the amino group True False

A: Proteins are the most abundant biomolecules present in organisms.

Q: Using proper convention, provide the amino acid sequence for the following peptide. O H3N-CH-C- CH₂…

A: For a protein, its primary structure refers to its amino acid sequence. As per the general rule, the…

Q: Estimate the pl values of alanine eTextbook and Media glutamate lysine

A: Answer 1) the PI value of the alanine is : 5.97  at 25 degree Celsius.  Answer 2) the PI value of…

Q: Write down the amino acid sequence of the tripeptide shown below. CH3 H H₂N NH -NH,

A: The above given figure is of a tripeptide. Since we know that an amino acid sequence begins with…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: Pleasr rewrite these answer by keyboard not in your hand.

A: Taurine is an amino acid, which is synthesized naturally inside our body. These help to grow tissue…

Q: Excess vitamin K in natural forms is not toxic, toxicity occurs with synthetic vitamin K called…

A: The vitamins are the essential nutrients which we get mostly from the food .

Q: Using proper convention, provide the amino acid sequence for the following protein. _8_#_H²-8-8° CH3…

A: There are twenty standard amino acids that makeup all the peptides and proteins inside the cell.…

Q: Using proper convention, provide the amino acid sequence for the following peptide.…

A: Amino acids are the biomolecules that act as monomer units of the major biomolecule "proteins".…

Q: Name the tests for aromatic amino acids .

A: Aromatic amino acids are those amino acids that contain aromatic ring as a side chain. Aromatic…

Q: ourse: EMS-3163-75635 X Mail-Anthony Arledge x P Course Home Active users Micro... Adobe Acrobat…

A: Labeled Image:    Brief Explanation of the Parts: Primary structure: The primary structure of a…

Q: Chemical formula of Nucleotides

A: The nucleic acids are formed from monomers called nucleotides. There are four nucleotides in DNA,…

Q: How do I find the volume of a 30% a 15% a 3% surcose. For these. I use 60gm of sucrose and and add…

A: Dilution rule To make 15% from 30% of sucrose V1×C1=V2×C2 V1×30=170×15 V1 =85 Therefore,  for making…

Q: write true if the statement is correct, otherwise, change the underlined word/phrase to make it…

A: Electrophoresis is an analytical technique which is used to separate a mixture of biomolecules such…

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: There are 20 naturally occurring amino acids. Each one has distinct properties and roles. Drawn is…

A: Lysine has 3 ionizable groups. They are an alpha-carboxylic acid group (highlighted in BLUE) , an…

Q: When referring to the amino acid sequences of proteins, sequence homology is the same as sequence…

A: single mutation leads to a homologous protein, and yet may drastically change the structure and/or…

Q: Which of the following is true about a peptide bond: Electron delocalization occurs between the…

A: Electron delocalization reaction in the peptide bond is given below.

Q: A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same…

A: Trypsin is basically a serine protease where it hydrolyses proteins. It is synthesized in the…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Dideoxynucleotides are often used to perform ____________________

A: There are four dideoxynucleotide triphosphates ddNTPs: ddATP, ddGTP, ddCTP, and ddTTP. ddNTPs do not…

Q: Which amino acid residue would be most effective at forming a strong intermolecular interaction with…

A: Amino acids have chemically diverse side groups that can participate is different types of…

Q: Which of the following characteristics would you predict the substrate to possess in order to bind…

A: Enzymes  They are a kind of proteins which act as catalyst in biological reaction.

Q: Describe the role of fructose 2,6-bisphosphate in the regulation of sucrose biosynthesis in plant…

A: Fructose 2,6-bisphosphate work as enzyme in synthesis of sucrose in chloroplast

Q: Determine whether each side-chain of the following amino acids is polar and neutral, nonpolar,…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: Write a brief paragraph about what a scientist could do with DNA. Could you please help me with…

A: DNA is the genetic material in most of the organisms including hunan. It is a nucleic acid that…

Q: How are inhibiting agents different from those that denature an enzyme? Use the paperclip button…

A: Enzymes are proteins that increment the pace of biochemical reactions. All proteins become active…

Q: What is the structure labeled "14"?

A: The respiratory system is the organ system in mammals that deals with the exchange of gases in an…

Q: Amino Acids Cys A lanine |-CH2 SH Leucine Isaleucine Leu Ser Aspartil acia Gly Ser Leu Serine…

A: Amino acids are the building blocks of proteins. These are identified by their names or a…

Q: Using proper convention, provide the amino acid sequence for the following peptide. O=C…

A: There are four classes of biological macromolecules- nucleic acids, proteins, lipids and…

Q: Agree or Disagree. Read the statement carefully & write your answer on the space provided.…

A: Introduction: Biomolecules are those molecules that help in the structure and function of the living…

Q: f) Identify -R groups that: Are hydrophobic, hydrophilic and aromatic • Are the H-bond donors and…

A: In the study of peptides and proteins, understanding their structural and chemical properties is…

Q: 4. Met - Leu- Ala - Gly - Glu - Gly - Gln– Glu – Ala – Ala - Pro - Leu 5. Met - His - Lys - Met-…

A: Nucleus is a main controller of the cell which consists of nucleic acid . It also contain thread…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: Please describe what is wrong with the mechanism (First part) in 280 characters or less

A: Aspartic proteases are a family of enzymes that cleave peptide bonds in proteins by using two…

Q: Question S end shoephete adre GLare H H oyaene Pyimdine bemes HO OH a. Label the strands as being…

A: Biomolecules also known as biological molecule is any of the numerous substances that are produced…

Q: what molecule is responsible for protein synthesis

A: mRNA molecule is responsible for protein synthesis .After transcription mRNA molecule goes to…

Q: Use the images to identify the amino acid sequence with the following DNA sequence (hint: transcribe…

A: DNA is transcribed to form mRNA. This mRNA is used as a codon for the formation of amino acid…