All of the following statements regarding celiac disease are true except ____. a. celiac disease is caused by an immune response to the glutenins and gliadins found in wheat, rice, barley, and rye b. there is a very high concordance rate for celiac disease in monozygotic twins, at around 75% c. all patients with celiac disease make autoantibodies specific for tissue transglutaminase d. celiac disease does not develop in individuals who lack the DQ2 and DQ8 allotypes e. early onset of celiac disease in children has been linked to repeated rotavirus infection.

Q: Chromosomal translocations AND mutations in cadherin binding sites can result in cancer. Select one:…

A: Introduction: When a segment of one chromosome separates and joins another chromosome, the process…

Q: Misfolded proteins are involved in four of the five following diseases. Select the exception.

A: A protein is considered to be misfolded if it cannot achieve its normal native state. This can be…

Q: O a. N-acetyl-galactosamine and N-acetyl glucosamine O b. D-galactose and N-acetyl glucosamine Oc.…

A: The blood groups are defined by the presence of specific carbohydrate sugars on the surface of red…

Q: Flow cytometry analysis was performed on the blood of an individual known to have been recently…

A: Rhino virus: it causes common cold, pneumonia in children.  Mycobacterium: it causes tuberculosis.…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal…

A: Protein electrophoresis is a method that separates proteins based on their size and the electrical…

Q: Wearing a face mask, hand hygiene, and social distance); all of these are ways to break the chain of…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia (AML) is a kind of blood cancer.

Q: Alpha-1 antitrypsin has codominant inheritance. M genes express normal levels. S and Z genes have…

A: Emphysema is caused by deficiency in Alpha 1 antitrypsin.This disorder causes lung diseases and…

Q: : how  does Aβ affects our body?

A:

Q: What type of substances are angiostatin and endostatin and where are they produced? What do they do?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the…

A: Any kind of alteration in the nucleotide sequence of an organism’s genome is referred to as a…

Q: PLEASE ANSWER BRIEFLY. Thank you. 5. In hairy cell leukemias (HCL), tartrate resistant acid…

A: Hairy cell leukemia is a type of  blood cancer  in which the bone marrow produces more lymphocytes.…

Q: order to reduce the social and economic burden, therapeutic methods to ND, such as AD and PD, should…

A: The paragraph is all about the cause of various neuro degenerative disease and the treatment plan.…

Q: A 47-year-old obese female complains of pain in her right wrist, with tingling and numbness in the…

A: Pressure on the median nerve causes the severe nerve damage and leads to severe symptoms

Q: hi, can I please get help on a case study on nueroanatomy I have been struggling for a couple of…

A: One of the two hemispheres that make up the brain is the right cerebral hemisphere. It is…

Q: Which of the given disorder can be seen in an individual when the mutation includes substitution of…

A: Purines and pyrimidines are nitrogenous bases present in nucleic acids. Substitution of purine by…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: The following chromosomal aberration is found in nearly 90-95% of all patients who have chronic…

A: In chronic myelogenous leukemia, BCR and ABL genes in close proximity on chromosome -22 BCR (present…

Q: Bloom Syndrome Bloom syndrome is a rare genetic disorder. It is characterized by short stature and…

A: The copying of DNA to make more DNA is known as DNA replication, Watson and Crick proposed that each…

Q: ALT is not used as a hepatocellular damage marker in cattle, Explain why.

A: Blood biochemical profiles are being extensively used in veterinary medicine not only for individual…

Q: A study is performed in persons with an immunodeficiency disease in which activation of macrophages…

A: Immuno deficiency disorders are he result of malfunctiong immune system which leads to faster…

Q: . One of the following sentences is NOT correct A. P53 is an example of tumour suppressor gene B.…

A: p53 is a tumour suppressor also called as guardian of the genome. p53 is frequently mutated gene and…

Q: 23. A 10-year old child presents chronic fatigue, growth retardation and epistaxis. On further…

A: Gauchers disease is a genetic disorder which occur due to deficiency of glucocerebrosidase.

Q: Although slow acting retroviruses lack oncogenes, retroviral infection can activate proto oncogenes…

A: Proto-oncogenes: These are normal cellular genes that help in promoting the proliferation of the…

Q: What leukocyte is increased in allergic reactions? As the cell matures, the cell diameter decreases,…

A: Leukocytes or white blood cells are cells found in immune system that protect the body from…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.