AKS 5c1: Given the statements below, what is the correct sequence of events for protein synthesis? * 1. DNA is used as a template to create MRNA 2. Amino acids are bonded together to make a polypeptide 3. MRNA molecule binds to a ribosome 4. The ribosome releases both the mRNA molecule and the polypeptide 5. TRNA binds to the ribosome 1, 2, 3, 4, 5

Q: Compare and contrast spliceosomes and ribosomes. Match each description to the correct structure.…

A: Spliceosomes and ribosomes are fundamental constituents of the cellular machinery, each serving…

Q: Differentiate the stepwise stages in protein folding.

A: Protein folding: a. Proteins are composed of amino acid chains that obtain their biological and…

Q: Describe the events of protein translation that occur on the surface of a ribosome.

A: The central dogma of life involves transcription of the DNA into mRNA during which the genetic code…

Q: Explain Stepwise Synthesis of Proteins on Ribosomes.

A: BASIC INFORMATION TRANSLATION  It is the process in which protein is which formed from the…

Q: BLE 8.2 DNA CODONS (3' END) CGT CCA CGT CCA mRNA CODONS (5' END) AMINO ACIDS IN PROTEIN CHAIN pose…

A: These questions are related to transcription and translation process. Transcription is a process in…

Q: Define transcription and translation. Give 3 ways in which they are similar and 3 ways in which they…

A: Central dogma of life is given by Francis crick in 1985.It gives an idea about flow of genetic…

Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…

A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…

Q: Which of the following correctly describes the order in which cell components function during…

A: Introduction: The process through which cells produce proteins, the necessary macromolecules that…

Q: What is most closely associated with the cell organelle in the process represented in the diagram ?…

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Choose the answer that has these events of protein synthesis in the proper sequence. (Note some…

A: The steps of Protein synthesis are collectively  called translation it involves forming proteins…

Q: Describe the covalent structure of an amino acid. Then describe the 4 levels of protein folding.…

A: Biomolecules or biological molecules are the molecules that make up an organism and are required for…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: Match the following with the correct process. converts DNA into mRNA occurs in the ribosome 1.…

A: All new proteins in the cell are formed by conversion of DNA to amino acids.  conversion of DNA to…

Q: Objective 11: Using the genetic code, demonstrate understanding of translation by converting a…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: ion, mRNA codons, peptide bonds, nucleus.

A: The process of transcription to translation decides the fate of genetic material. Both of the…

Q: TRNA * Carries amino acids in the cytoplasm to ribosomes for protein assembly Amino Acid attachment…

A: The correct answer is (b) amino acid attachment site across from anticodon site on tRNA Transfer…

Q: Identify the site of ribosomal subunit assembly?

A: Ribosomes occur in all organisms both in prokaryotes and eukaryotes with the exception of mammalian…

Q: describe how ribosomes, mRNA, and tRNA cooperate to produce a protein?

A: Ans: The proteins are synthesized from mRNA using the process called translation, which involves…

Q: Which of the following sequences is most likely to represent a beta-sheet portion of a protein? O…

A: The β-sheet is a secondary structure motif of the protein structures. it is formed by the β-strands…

Q: Having made it through Cell Molecular Biology this far, you are now an expert on cells and their…

A: Proteins are polymers made of amino acids as monomeric units. There are 20 different amino acids…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: The central dogma of life is as follows  DNA - RNA - Protein Thus to make protein we require RNA…

Q: Which of the following statement about RNA is FALSE? rRNA is critical for protein synthesis as it is…

A: Ribonucleic acid (RNA) is a nucleic acid which has similar features to DNA and is found in all…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: Which of the following statements about ribosomes is true? Eukaryotic ribosomes have a P site,…

A: Ribosomes are the cell organelle that helps in the process of translation. The structure of…

Q: Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by…

A:

Q: 5' 2. Explain what indicates the beginning of translation, and what tRNA's role is in translation.…

A: TRANSLATION: The method used by a cell to produce proteins utilizing genetic information conveyed by…

Q: Describe the journey of a protein from the ribosome, to the ER, Golgi and then out of the cell.

A: Proteins are distributed in the cytosol, plasma membrane and the organelles like, nucleus,…

Q: Explain the roles of oxygen and glucose in aerobic respiration? Plasma membranes are selectively…

A: Introduction  The plasma membrane is a thin layer of lipids and proteins that forms the boundary…

Q: Which characteristic of mRNA is INCORRECT? Bacterial mRNAs vary in size but usually have about 1000…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…

A: Amino acids - are building blocks of proteins and alpha carbon of amino acids contains amine group,…

Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…

A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…

Q: Match the molecule with its correct description

A: mRNA - Carries a copy of the genetic "message". tRNA  -   Has anticodons Aminoacyl tRNA synthetase -…

Q: Answer the following questions: 1.) In your own words, describe the different steps in prorein…

A: Protein synthesis is the process by which proteins are formed in biological cells.

Q: The diagram shows a pre-MRNA before splicing and processing. In this cell type, a protein is present…

A: RNA-Splicing:  In molecular biology, RNA splicing is the process by which a newly synthesised…

Q: How is the relationship between the tRNA and mRNA achieved?

A: Proteins are built from smaller units known as amino acids, that are fixed by three-nucleotide mRNA…

Q: Q1: Which amino acid always begins an amino acid chain? Which codon and anticodon are associated…

A: Introduction The genome consists of DNA/RNA consisting of either deoxyribose nucleotides (In DNA) or…

Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…

A: Please follow step 2 for detailed explanation.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.