A flask contains a mixture of compounds A and B. Both compounds decompose by first-order kinetics. The half-lives are 50.0 min for A and 18.0 min for B. If the concentrations of A and B are equal ini- tially, how long will it take for the concentration of A to be four times that of B?

Q: Structures 1-3 are ___. Stabilized by hydrogen bonding The result of protein amino acid sequences…

A: This question is related to amino acid.   Structure 1 is an example of alpha helix. Structure 2 is…

Q: After an electrophoresis experiment, how are the lengths of the DNA fragments in each lane…

A: In electrophoresis experiment is a technique to determine the size of DNA molecules on passing the…

Q: help please answer in text form with proper workings and explanation for each and every part and…

A: Step 1: Generally peptide bond is a bond occurs  between two amino acids. Each amino acid has two…

Q: . Which of the following is found in a DNA nucleotide? (Sec. 20.6) (a) deoxyribose sugar (b)…

A: A nucleotide is a compound which contains 3 component units, namely a pentose sugar, a heterocyclic…

Q: QUESTION : Supposed you used the enzyme lyase in the biomolecular laboratory, identify reaction that…

A:

Q: 3. Draw the structure of the DNA oligomer that would perfectly base-pair with the following sequence…

A: DNA has a double stranded structure and both the strands are complementary to each other.  For…

Q: Explain how a polyamide is able to bind to minor grooves and disrupt transcription.

A: Polyamide is a polymer in which a repeating unit is an amide group with a general chemical formula…

Q: To be a nucleotide OR protein it MUST have a nitrogenous group.  This answer is wrong.

A: Ketone group found in the system.

Q: What is different about the primary structures of RNA and DNA? Match the words in the left column to…

A: DNA and RNA are types of nucleic acid .DNA stands for deoxyribonucleic acid and RNA stands for…

Q: Given

A: ✓1-Breadhave comparatively more gluten and cake have least among the three,so bread have highest…

Q: Please create a concept map about macromolecules.

A:

Q: Define captopril ?

A: Captopril is a drug used to treat high blood pressure and congestive heart failure. Its IUPAC name…

Q: What property is used to separate DNA fragments during a gel electrophoresis experiment? Select one:…

A: Gel electrophoresis is used to separate the DNA fragments on basis of their size and charge.

Q: (i) Why does DNA contain thymine iństead of uracíl? Justify. (c) In acidic solutions Tüj nucleosides…

A:

Q: Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon…

A:

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: SOURCE: GENERAL ORGANIC AND BIOLOGICAL CHEMISTRY by Smith 4th Edition

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: Part A be found in hydrophobic regions Check all that apply. histidine phenylalanine O serine Submit…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 3. The following questions are based on the polypeptide chain below. a) How many amino acids are…

A: Amino acid are special biomolecules which have basic amine and acidic carboxylic group present Here…

Q: Blue fluorescent dye that identifies DNA. Heoscht Stain Fluorescence Insitu Hybridization O Giemsa…

A: Fluorescent chemical is a compound that can re-emit light upon excitation of light. Fluorescent dyes…

Q: picture shows the grabber protein backbone and the 4 Mg++ ions as pink balls. The picture to the…

A: We have to tell how Mg2+ held in the cavity of the grabber protein backbone. More specifically we…

Q: Could you help me with these questions, please? My teacher will not help me. Thanks so much!! 1)…

A: Carbohydrates are the component of food. They are also called sugars. Aldohexoses are the…

Q: Be sure to answer all parts. Draw the structure of a naturally occurring amino acid that is an…

A: We have to draw the structures of the amino acids

Q: the name for the three-dimensional VSEPR structure.

A: The given molecular structure is that of typical sp3d2 hybridised system, which gives a penta…

Q: Review View Help Enable Editing need to edit, it's safer to stay in Protected View. Question 7 MgBr…

A:

Q: X: reproduce the interatomic interactions Y: define a computable energy (such as Gibb's free energy)…

A: The complete structure of a protein can be divided into 4 based on the complexity: primary,…

Q: QUESTION 19 Briefly explain why there are + and - charges in the amino acid structures in the table…

A:

Q: what was neoprene ultimate goal

A:

Q: ______________ are stereoisomers that are not mirror images.

A: There are various types of stereoisomers. Some of which are -  1- enantiomers 2- Diastereoisomers

Q: In comparing CH3CH2OH and CH3(CH2)10OH, which one would be more soluble in heptane? Fully explain…

A: The question is based on the concept of solubility.  solubility follows a basic principle "like…

Q: Question 1 A(n) bond is a bond between sulfur atoms in a protein. Covalent... weak Peptide.. ionic…

A: Proteins are long chain of amino acids(peptide) having high molecular mass.

Q: DNA Replication 1) Construct the complementary strand of DNA (strand II) that would pair with the…

A: DNA replication is the process by which cells duplicate their genetic material before cell division.…

Q: Draw the hydrogen bonds between A and T that hold the double helix together. Show both molecules and…

A:

Q: An amino acid is usually more soluble in aqueous solvent at pH extremes than it is at a pH near the…

A: We know, aqueous solvents are usually polar in nature and polar solvents dissolve polar compounds…

Q: This structure indicated a peptide bond between alanine and threonine. Using a pen, draw a…

A: Step 1 - N-protection of n-terminal Amino acid (Alanine) Using tboc functionalityStep 2 -  C -…

Q: h) What do you mean by Auxochrome and Chromophores?

A: Auxochrome is defined as a group of atoms which is functional and has the capability to alter the…

Q: Please draw the resulting structure when the above nucleic acid bonds with an identical nucleic acid…

A: The solution is given below -

Q: Draw the condensed structure for butane and explain the steps you have use and also explain why your…

A: The condensed structure of any organic compound is written in a straight line form by completing the…

Q: See attached image. Based on the results given above, which statement is most true?  Sample A is a…

A: a. Molisch Test is for detecting all the carbohydrates. b. Benedict Test is for detecting reducing…

Q: a. Name the following compounds. b. Draw the nucleic acid backbone which is formed from these…

A: Nucleic acids are chemical compounds that occur naturally and serve as the primary…

Q: Classify attached radical as 1°, 2°, or 3°.

A: The type of radicals can be identified as

Q: H н H.C Н CH₂ I н CH₂ i Н Н H. C на H Ï CH₂ H H Н | Н H

A: Amino Acid  Amino acid are white crystalline solid . It contain both basic amino group(-NH2) and…

Q: Correct each molecule in the drawing area below so that it has the structure it would have if it…

A: The question is based on the concept of organic reactions.We need to identify the product formed…

Q: I have a research project in Computational Chemistry Course entitled “Predicting binding of…

A: Carbohydrate-binding proteins will be proteins that can connect with sugar chains yet don't adjust…

Q: n one. Match enzyme or molecule with its function in bacteria. Answers may be used more than once or…

A: 37. RNA polymerase is the main enzyme in catalyzing DNA→ mRNA transcription.  38. DNA helicase…

Q: Please correct answer and don't use hend raiting

A:

Q: QUESTION 18 Sample A is diluted by adding 50 uL to 950 ul of buffer to make solution B. Solution B…

A: The relation between the concentration of solution and absorbance is given by Beer Lambert's law.…