A female fly is heterozygous for hairy body (hb), fluted wings (fl), and detached wing veins (dt). This fly is test-crossed, and the resulting progeny are listed in the following table. Phenotype hb fl dt + fl + + + hb + dt fl + hb fl + + + dt hb + + dt Total Tol + 28.5 13.6 9.1 12.5 26.1 Number of gametes 60 65 56 372 376 3 6 What is the map distance between fluted wings and detached wing veins? 62 1,000

Q: Use your own words, explain! (1) the working mechanism of Magnetic Resonance Imaging (MRI); and (2)…

A: MRI ( Magnetic Resonance Imaging) Magnetic resonance imaging or nuclear magnetic resonance imaging,…

Q: pneumothorax occurs when the chest wall is punctured and air moves down its pressure gradient from…

A: This statement is INCORRECT. in PNEUMOTHORAX excess air gets collected in the pleural cavity between…

Q: QUESTION 22 Mst digeston Hb*I Hb HDI HD Hb*I Hb E 1.35 kb E 1.16 kb Southern blot The figure above…

A: As indicated in the RFLP and restriction digestion analysis of the HbA and HbS gene there is a…

Q: Mutations on chromosomes may affect proteins. These mutations may be__to the structure and function…

A: Chromosomes are filamentous bodies composed of DNA and histone proteins. DNA( deoxyribonucleic acid)…

Q: QUESTION 42 Taylor enters the doctor's office. The nurse takes Taylor to an examination room where…

A: Electronic health records (EHRs) are digital representations of a patient's medical history, which…

Q: discuss strategies that the instructor could use and has already used to help baylie improve her…

A: Medical terms will be used used in several combinations like.. root + suffix prefix + root prefix…

Q: Salma Rick Layla Adie Mac A Rh A Rh Rh Rh Rh B B B The blood type for Salma is The blood type for…

A: The blood type for Salma is A positive The blood type for Rick is AB negative  The blood type for…

Q: Cell Form Function a. Spinal cord i. White matter ii. Gray matter b. Cerebellum i. Purkinje cells…

A: The spinal cord is a long tubular structure composed of nervous tissue extending from the medulla…

Q: Question 26 transcription activator bound at the activator binding site O Gene is switched ON O Gene…

A: Ans - Transcription activator bound at the activator binding site to switch on the gene.  # These…

Q: QUESTION 19 Muscle contraction is inhibited when: The Ryanodine Receptor is open Inhibitory motor…

A: Muscle is a soft tissue and muscles cells are composed of protein actin and myosin.Muscle helps in…

Q: Describe the mechanism of action for the statins.

A: The mevalonate pathway is the metabolic pathway that produces cholesterol and other isoprenoids.…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: Question 24 Tryptophan-repressor complex binds to operator O Gene is switched ON Gene is switched…

A: Tryptophan operon is a biosynthetic process in Ecoli in which group of genes that is associated with…

Q: stion 8 Your client was recently diagnosed with cancer terminal stage. After your assessment you…

A: Nursing assessment is the assessment done by the nurses to know the health status of the patient.…

Q: Review after transcription modification. Match the term and its description. Each term can only be…

A: The process of converting a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: Dr. He Jeankui was jailed for three years starting in 2019 because O A. He cloned two children which…

A: Cloning is not the same as genetic engineering. Cloning produces an identical copy of all or a…

Q: question 16

A: Heart is the major organ of the cardiovascular system. It is the mesodermally derived organ and it…

Q: QUESTION 11 micro-RNAS (MİRNAS) regulate gene transcription MRNA translation and stability splicing…

A: A microRNA is a small single-stranded non-coding RNA molecule found in all organism, that…

Q: "A client's leg wound was swollen and there was foul smelling, thick, yellowish discharge over his…

A: A wound is referred to as an injury to the living tissue due to a cut or force in the skin. There…

Q: What process is being depicted here? 3000 ÷

A: Protein synthesis stands as a pivotal process within our bodies, comprising two fundamental steps:…

Q: RNA polymerase synthesis in a 5-3 direction O Gene is switched ON O Gene is switched OFF O Does NOT…

A: Transcription is the process of synthesis of an RNA molecule from the template strand of the DNA…

Q: Question 15 Juan used the ABO blood testing kit to determine his blood type. His test showed the…

A: The question is asked about the blood group based on the findings that the person named Juan have…

Q: estion 26 Your client was ordered Fucidine cream for the skin infection on her leg. What specific…

A: Antibiotics are a form of antimicrobial drugs that fight against disease-causing pathogenic…

Q: Question 22 Elodea lives in aquatic environment. It does not have a contractile vacuole. How come…

A: The movement of water across a semipermeable membrane (plasma membrane) from lower concentration…

Q: QUESTION 25 Lymph nodes are made of masses of lymphocytes surrounded by a capsule. The lymphocytes…

A: Lymph is a transudate of blood, and it has similar proteins as that of plasma, but the amount is…

Q: 8. The membranes (envelopes) that coat some viruses consist of

A: Introduction A virus is an infectious submicroscopic creature that only reproduces inside of live…

Q: I need to know the function and the cell form(columnar, Cuboidal, and  Squamous, and where the…

A: Cell type  function nucleus location columnar protection is the main function against any bacteria…

Q: Long Answer Essay You are seeing a patient in your office with a primary complaint of excessive…

A: The most common causes of excessive daytime sleepiness are sleep deprivation, obstructive sleep…

Q: Question 23 Repressor protein binding at DNA upstream O Gene is switched ON Gene is switched OFF…

A: The repressor is a small protein molecule that acts as the binding protein which inhibits the…

Q: Question 68   An 80-year-old client with arthritis in both hips is rating her pain as 3 out of 10…

A: Arthritis is a condition affecting different joints of the body, causing inflammation. There are…

Q: Offspring (new cell) DNA is identical to the parent DNA in: mitosis O meiosis O both

A: Cell division is required for the growth, repair and formation of reproductive cells. Cell division…

Q: question 17

A: Heart is the major organ of the cardiovascular system. It is the mesodermally derived organ and it…

Q: Question 15 Accommodation refers to compensation between the eyes when light rays focus on the blind…

A: Eye is a sensory organ. It is responsible for visualising the objects.

Q: Small nuclear RNAS (SNRNAS) regulate O gene transcription O MRNA transport into the cytoplasm O MRNA…

A: Answer) Small nuclear RNAs (snRNAs) regulate the splicing of mRNA precursors. Small nuclear RNAs…

Q: DNA is chemically stable than RNA due to the on

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: A BIO101 student says, "Dr. Lopes spend all our time talking about DNA, but that's silly because DNA…

A: DNA and RNA are the genetic material. These carry the information from one generation to another.…

Q: Describe the exact DNA mutation that has occured, to create the mutant dystrophin allele.

A: Complex of dystrophin and glycoprotein (DGC). Dystrophin is a rod-shaped protein that binds the…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.