8. If an atom has 35 protons in the nucleus, how many electrons will it have orbiting the nucleus? 9. What is the atomic number of the atom in the diagram above? 10. What is the atomic mass/mass number of the atom in the diagram above? 11. How many protons are in the nucleus of an atom with an atomic number of 15? 12. How many electrons are in an atom with an atomic number of 20? 13. How many neutrons are in the nucleus of an atom with an atomic number of 25? (use Periodic Table for mass) 14. What is the mass number of an atom with 3 protons, 4 neutrons, and 3 electrons? 15. How many neutrons are in the nucleus of an atom that has an atomic mass of 36 and an atomic number of 25?

Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…

A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…

Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…

A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…

Q: From the choices below, which are reputable sites that can be used to locate scientific journal…

A: Science is a term which is used for the study of the subject which is based on the facts and…

Q: Part 1: Graphing Biotic Potential 1. Make a table to show the data (# flies/generation). for one…

A: Given that one female fly can produce 120 eggs in one generation. Of these 120 eggs, half (60) will…

Q: Answer questions 12-16 , I need the letter of your answer

A: Environment refers to the area where organisms live. Ecosystem is the organised community of living…

Q: Can you please answer 32

A: Any alteration in the genome’s nucleotide sequence is called a mutation. It may involve small-scale…

Q: НО `CH2 В 2. Consider the structure of the disaccharide drawn at right: OH (a) Give the names and…

A: Carbohydrates are biomolecules that can be either monosaccharides, disaccharides, or…

Q: Digestive Enzyme Activity Tan-protease ...... - W-protease --- 4 8. 10 12 pH Based on these data and…

A: In this question, scientist identified two enzymes which are found to function in the digestive…

Q: Plz answer this question

A: We can say that The Vertebral columns or spine help to form the backbone. This helps to protect the…

Q: When you examine the phenotype of wings - why can you conclude that wings & flight are analogous…

A: Change in visible characteristics of an organism which takes place from many generations is called…

Q: Would you be able to assist with questions 3 and 4? (I know that will count as two questions)

A: Mutations in the DNA happen at random and are not directed in any way to bring about a positive or…

Q: A nurse is conducting an assessment of a community's nutritional status. Knowing that each person is…

A: Note: Since you have asked multiple question, we will solve the first question for you. If you want…

Q: b. Given this cross, TIGG X TIGG, fill-up the squares with the correct answer.

A: Please see full answer in step 2.

Q: 7. What type of insulin is used for insulin pump therapy? a) Long-acting insulin b) Rapid-acting…

A: Diabetes mellitus It is a chronic metabolic disorder characterized by increased blood glucose or…

Q: n tamarins were released into their natural habitat but found most were very underweight, presumably…

A: Gel electrophoresis is a technique used to separate DNA fragments according to their size. In order…

Q: Matching (may be used more than once or not at all) a. plasma membrane b. centriale c. endoplasmic…

A: Cells can be described as the smallest functional unit of living organisms which are responsible for…

Q: glucose will be more readily phosphorylated by glucokinase than hexokinase hexokinase will…

A: The main difference between the enzymes Glucokinase and Hexokinase is their location. Hexokinase is…

Q: The pKa of the HEPES buffer is 7.55. What is its effective buffering range? Any pH below 7.55 Any pH…

A: HEPES means hydroxyethyl-piperazineethane sulfonic acid. Buffers are the solutions that resist the…

Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…

A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…

Q: Anabolic pathway A. Energy required to make a chemical reaction proceed forward Exergonic B. Second…

A: Reactions refer to the chemical process involving the reactants to form different substances called…

Q: What is the most likely diagnosis of this individual's disorder? What mechanisms regulate the…

A: Thyroid gland:  It is a "butterfly-like" gland present in our neck and controls the release of…

Q: Examine the table showing the classification of four questions. Taxon Domain Kingdom Phylum Class…

A: Classification is the process of grouping things together based on shared characteristics. In…

Q: 2. What is the purpose of teeth? a. increase food's surface area b. decrease food's surface area c.…

A: Introduction  The digestive system is the group of organs responsible for the ingestion, breakdown,…

Q: X-Linked Recessive Disorder: Color Blindness 3. Color blindness is an X-linked recessive disorder in…

A: An individual who suffers from color blindness is unable to distinguish between red and green…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Which of the sugars below are diastereomers of compound I? CHO H+ OH H-+OH H+OH CH₂OH I CHO H-OH…

A: Stereoisomers are the type of isomers in which the chemical formula of the molecules as well as the…

Q: Compare and contrast peptide hormones, steroid hormones, and amine hormones. Be sure to talk about…

A: The endocrine system is a vital ductless system of the human body that is concerned with the…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…

A: This question is about interpreting a scatter plot with a regression line from an experiment that…

Q: 3. Glycogen phosphorylase converts glycogen into glucose monomers and is the rate limiting step in…

A: Introduction Glycogenolysis involves the formation of glucose monomers from glycogen by a process of…

Q: 15. LO1.3 The respiratory systems primary function is to: a. Fight infection. b. Warm the air. c.…

A: Physiology is the study of normal functions within the living. It involves the study of various…

Q: 1. Accessory structures of the eyes include O A. Intrinsic eye muscles, Eyebrows, Lower Conjunctiva,…

A: Eyes also called as photoreceptors are the organ of site located inside orbits or eye sockets which…

Q: Table 15-1 (fill in the numbers as indicated) TABLE 15-1 NUMBER Bone Count Related to the Lower…

A: Bone is a metabolically active connective tissue that aids in mobility, protects essential organs,…

Q: 2. (A) What is the name of the key orexigenic neurons in the arcuate nucleus ARC. (B) These neurons…

A: The central nervous system (CNS) is one of the two major divisions of the nervous system. It…

Q: Plz do questions

A: Bone is a specialized connective tissue that is formed of cells and extracellular substances- matrix…

Q: Starting appear in squalene. 14 H3C COA 5.) Starting with the following radiolabeled acetyl-CoA map…

A: Introduction: Biosynthesis of cholesterol occurs from the acetyl-CoA in four stages.

Q: Which of the following is not true of diabetic retinopathy? retina blood vessels swell blood glucose…

A: Answer 1 Option C is correct :  Higher than normal HDL cholestrol levels

Q: is the 2nd amino acid in the peptide produced from the C-terminal is the anticodon present in the…

A: A Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or…

Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…

A: Water  It is the most important material on the planet eart. Water makes life possible as almost…

Q: What are some recommendations to clinicians interested in incorporating body composition methods in…

A: Introduction :- Body composition means that the chemical compounds that makes up the human body , in…

Q: myelinate axons? Take a look at the images below and explain the process of myelination in each…

A: Myelination helps in promoting rapid, efficient nerve conduction. It also made possible the…

Q: One of the biggest obstacles to the widespread use of ultrasound for body composition estimation in…

A: Impedance is defined as the resistance to current flow. The bioimpedance devices/techniques employ…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.