8. Explain the extent to which Michael Platiensis's account is a reliable source of evidence about the spread of the Black Death. Questions to consider when describing a source's reliability. Your responses to task #8 Doesthe source include evidence about the given topic? Is the source primary or secondary? Is the author biased? What are the limitations of the source to give evidence about the topic?
Q: Arrange the best steps to take to identify the gene and mutation that causes the lung cancer. Not…
A: The quest to uncover the genetic basis of lung cancer presents a complex challenge, requiring an…
Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…
A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…
Q: In some chickens, the gene that produces color shows incomplete dominance. The gene will produce…
A: Incomplete dominance is a form of intermediate inheritance in which one allele for a specific trait…
Q: When blood glucose levels are low, glucagon is secreted trom the pancreas Into the bloodstream…
A: Hormone glucagon is a pancreatic enzyme that is secreted in response to low levels of glucose in the…
Q: Fill in the blanks in the selection below. Use the video to help you. A DNA molecule is made up of a…
A: The process by which the parental characters are inherited from the offsprings is known as…
Q: Glutamate dehydrogenase functions to produce ammonia for the urea cycle. Use the standard reduction…
A: Glutamate dehydrogenase is the enzyme that is responsible for the production of ammonia. Ammonia…
Q: 2. Consider three groups of solutes: (1) steroid hormones, fatty acids, and other lipids; (2)…
A: 2. There are different mechanisms of transport which allows the movement of the molecules across the…
Q: Which of the following statements about this monohybrid cross are true? Select all that apply. U 00…
A: Introduction A monohybrid cross is a genetic cross between two individuals that are heterozygous…
Q: Two heterozygous black pigs are mated. Show the genotypes, phenotypes, and probabilities of the…
A: Answer
Q: answer in correct order and please answer quickly
A: In a developing fetus, various processes occur in order to form the basic body framework, that is,…
Q: Koala bears AaBbCc were testcrossed. The results: Phenotype Number AbC 5 Abc 52 abC 373 abc 72 АВс…
A: Given:
Q: Let's take a closer look at the mandible, which is the only moveable bone in the skull. A process is…
A: Mandible is also called the lower jaw or lower jaw bone. It is the only movable bone in the human…
Q: expressing dominant mutant trait, caused by the "A*" allele %3D expressing recessive mutant trait,…
A: Dominant traits are expressed in both situations ie in homozygous or heterogegous condition…
Q: In some cats, the length of the tail shows incomplete dominance. The tail can be long (L), short…
A: Incomplete dominance also called as partial or incomplete dominance, a phenomenon in which two true…
Q: Answer this question asap quickly fast thanks
A: Endocrine hormones are released by the endocrine glands directly into the bloodstream. Thus,…
Q: From the following choices, select the DNA sequence that is classified as a mirror repeat. ATCATC O…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…
Q: Decreased extracellular pH often results in metabolic acidosis. Lower pH will shift the reaction…
A: The correct answer to this question is option A. Here the condition described is metabolic acidosis…
Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…
A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…
Q: A. Natural disturbances have an important role in maintaining an ecosystem's dynamic equilibrium. B.…
A: Introduction An ecosystem is a community of living organisms, together with their non-living…
Q: A normally pigmented woman who is a non-taster has a father who is an albino taster. She marries an…
A: Punnett square can be used to predict the probabilities of phenotypes and genotypes in future…
Q: COOH Fumarasa COOD H. COOH CH DO H- H2O, pH=7.4 ČH2COOH D H. НООС H. (S) -malic acid Fumaric acid…
A: Tricarboxylic acid cycle is also referred to as citric acid cycle and is an important step in the…
Q: ity to straighten the little finger Hypercholesterolemia (the most common human Mendelian disorder)…
A: Cystic fibrosis is a genetic disorder that results in the buildup of thick mucus. It also leads to…
Q: 1. Cirde and identify three different functional groups on the following diagram OH 1. 2. 3.
A: Functional groups are the unique arrangement of atoms in a molecule. They impart distinctive…
Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…
A: Introduction: Complementarity is the fundamental concept of DNA replication and transcription since…
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…
Q: Number of Colonies of Bacteria 40 20 Colonies of Bacteria at Various pH Levels 4 5 6 7 8 9 pH 10 5.…
A: Introduction :- Ph is the potential of hydrogen ions in a solution and is used to measure the…
Q: 5. Active transport allows cells to maintain higher concentrations of many different molecules than…
A: Membrane transport of polar or charged species requires additional help from channels or transporter…
Q: QUESTION 26 If you are required to add 25 ng (nanograms) of a solid into 50 uL (microliters) of…
A: 1 ng = 0.001 microgram (mg)
Q: Which of the cells in the diagram will eventually develop into macrophages? Courtesy Michael Ross,…
A: Leukocytes, otherwise called WBCs or white platelets, comprising moment particles called cytoplasmic…
Q: Figure 14.4 50 |Passengers | Crew 40 30 • Half-day **Cruise cancelled 20 10 10 11 12 13 14 15 16 17…
A: Introduction The invasion and proliferation of pathogens in the body is known as infection.…
Q: Answer quickly fast
A: We can say that Frogs depend on the various kinds of muscles to carry out their normal daily life…
Q: (LO 8.5) Which mineral's most vital role is to help form hemoglobin and collagen? O fluoride O…
A: 1) The question is related to the role of minerals in the human body. More specifically, it asks…
Q: D. Hardwood forest stage C. Pine forest stage A. Grass stage B. Shrub stage Bare field 1. What…
A: 1. In the diagram, succession concept is illustrated as initially it is the bare field and then…
Q: Why is it easy to transform a bacterial cell and then use that to transform an animal or plant cell?…
A: In molecular biology, transformation is the process where the genetic alteration of a cell is…
Q: Now that you have learned about respiration and photosynthesis, how do aerobic respiration,…
A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…
Q: Čritical Thinking 1. Use what you know about carbohydrates and lipids to group the following…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: In Michaelis menton kinetics which variable is held constant? multiselect a. substrate concentration…
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: - After you are finished, list each step for the Gram staining procedure. - Which of the four steps…
A: NOTE: AS PER OUR GUIDELINES WE NEED TO ONLY ATTEMPT FIRST QUESTION AND ITS PARTS , PLEASE RESUBMIT…
Q: 1-4 Answer 0 White Fur in a recessive trait (F) while. brown Fur is the completely dominant trait…
A: According to Hardy-weingberg law "In absence of forces that change gene frequences, relative…
Q: 4. Which statement is accurate regarding the relationship between the remora fish and the shark…
A: 4. Remora is a tiny fish of about 1-3ft in length. They possess a suction cup-like organ on the top…
Q: Match the following steps with the order in which they should occur when using a stereomicroscope.…
A: Compound and stereo microscopy are the two most common types of microscopes. Stereo microscopes have…
Q: Please answer in detail ASAP
A: Carbohydrates are macronutrients and one of the three basic sources of energy for our bodies. They…
Q: Select all of the intermediates of glycolysis that are used to generate ATP by substrate-level…
A: 1,3-BisphosphoglyceratePhosphoenolpyruvateExplanation -During glycolysis, the phosphorylation of ADP…
Q: c) heterozygous long x homozygous long Genotypes Phenotypes d) heterozygous long x heterozygous long…
A: Since there are multiple questions in this particular question, I'll answer the first three subparts…
Q: 9. In guinea pigs, rough coat is dominant (R) to smooth coạt (r), and black coat (B) is dominant to…
A: The genotype of the rough, black guinea pig is RrBb (heterozygous for both alleles) The genotype of…
Q: Results of AaBb x aabb, where genes A and B are linked: 14 dominant for A but recessive for b 16…
A: This is the case of test cross. The unknown genotype bearing parent is crossed with homozygous…
Q: Earth's Interior and Surface and Pangaea 1. What do Earth's continents have in common with a jigsaw…
A: Continental drift is the theory that the Earth's continents have shifted relative to each other over…
Q: The measured distance between genes D and E in a two-point testcross is 50 map units. Where are…
A: The genes D and E are said to be 50 map units apart based on a two-point testcross. This distance is…
Q: 1. Write the mRNA strand that would be created based on the DNA strand below. 2. Write the tRNA…
A: Deoxyribonucleic acid or DNA is the molecule that contains the genetic material in living organisms…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps