5.18) Determine whether the following statements describe insulin, glucagon, or both insulin and glucagon. a) secreted by pancreas both insulin and glucagon b) released when blood glucose concentration is high insulin c) released when blood glucose concentration is low glucagon d) immediately increases the amount of glucose entering cells insulin e) is a hormone both insulin and glucagon f) lowers blood glucose concentration insulin g) not enough is produced by individuals with type-1 diabetes insulin h) stimulates glycogen breakdown (glycogenolysis) glucagon EXPLANATION: When insulin binds to liver and muscle cell receptors, it triggers a series of events that result in the activation of an enzyme in the glycogenesis pathway and the inhibition of an enzyme in the glycogenolysis pathway. Glucagon has the opposite effect of insulin on liver cells; it accelerates glycogenolysis and suppresses glycogenesis causes a decrease in blood glucose levels • accelerated by insulin • suppressed by glucagon glucose glycogenesis glycogen glycogenolysis causes an increase in blood glucose levels • accelerated by glucagon suppressed by insulin

Q: Thank you so much! Are you able to draw a simple picture to back up any of these 12 reasons? I'm a…

A: Neuron is a basic structural and functional unit of nervous system. Each neuron is a nerve cell…

Q: CENCE P

A: White blood cells are present in our blood as blood elements’ components and they protect our body…

Q: I believe ut should be Asn Ala Val Tyr Ala Arg Met Tyr

A: A peptide is a short chain of amino acid residues linked together via a peptide bond. As per the…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: Label the ear model b D E - Y - E z o E

A: The diagram is of the internal structures of left side of the ear   NERVES  COCHLEAR NERVE…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase)  Mitosis is a type of cell division in which a cell…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: Match the following VA V B " .. V C V D VE A. Aqueous humor B. Vitreous humor C. Cornea D. Choroid…

A: Sense organs are the structure in the body that catch up external stimuli and provide response to it…

Q: a neural impulse; a brief electrical charge that travels down the axon the junction between the end…

A: Here are the correct matches to all the definitions listed.

Q: Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to…

A: The DNA inside the cells contains all the necessary information for protein production. For the…

Q: Could you help me with the punnett square?

A: A Punnett square is a visual tool used in genetics to predict the outcomes of a cross between…

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…

A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…

Q: Language and verbal skills tend to be side of the brain of right-handed people. concentrated on the…

A: The brain is one of two components (the other being the spinal cord) that is the epicenter of the…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Can u answer your qustions

A: Need to find the answers the given questions below with reference to the graph.