Q: During a crossover event, more nonrecombinant than recombinant gametes will be produced. O True O…
A: Introduction Crossing over refers to the exchange of DNA between paired homologous chromosomes that…
Q: What made the angiosperms the most successful terrestrial plants? Discuss your answer.
A: Answer Angiosperms are the most dominant form of plant life in most terrestrial ecosystem.
Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.
A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…
Q: septic shock is a life -threateningcondition caused by an overwhelming A inflammatory…
A: C. most suitable answer is.. Failure of blood clotting cascade.
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: The normal flow of electrons through the electron transport chain is blocked by sodium azide. Which…
A: The citric acid cycle and electron transport chain is the aerobic stages of cellular respiration.
Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…
A: ATP is the currency of the cell and it starts with glycolysis. Glycolysis is the breakdown of…
Q: 10. Ꮽ 11, 5
A: Introduction The ovary is a female reproductive system organ that contains multiple eggs (Ovum).…
Q: what is a creation myth? why is knowing the creation myths important
A: What is creation myth- A creation myth is the narrative about how people came to inhabit and how…
Q: What are initiatives that have to be done lower your household’s vulnerability to climate change
A: Environmental change drives have huge scope efforts to battle an Earth's global warming temperature…
Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…
A: Induction is the process by which the presence of one tissue influences the development of others.…
Q: What types of cells are used for cloning rDNA?
A: rDNA is called recombinant DNA which contains DNA from multiple sources. Recombinant DNA is it's the…
Q: 2. An ecologist spent a year studying the population dynamics of a species of duck on a lake. At the…
A: Introduction Migration, in ecology, is the seasonal movement of animals from one habitat to another…
Q: Helping tags: Biology, microbiology, Vibrio spp. It's a common practice in some countries to eat…
A: Oyster refers to a group of salt-water bivalve molluscs that dwell in marine or brackish…
Q: G. Tactile Location 1. 2. 3.
A: Answer G. Tactile location
Q: Now, solve the following problems involving radiation: 1. Why is 1 mGy of alpha radiation considered…
A: Alpha particles is double ionized helium He++ ion. The beta particles is electron like elements.…
Q: Define the genetic disorder Huntington's disease and the mode of inheritance (Dominant, Recessive,…
A: Answer 1 : Huntington's diseases is the condition in which the nervous cells breaks in the brain…
Q: What function do the malleus, incus, and stapes bones in the inner ear play in processing sounds?…
A: The malleus, incus, and stapes bones also known as auditory ossicles . Present in the Inner ear .…
Q: Between the respiratory and urinary systems, which would you say is easier to achieve homeostasis
A: Homeostasis is the condition of consistent internal, physical, and chemical circumstances kept up…
Q: A cladogram or phylogenetic tree is used to classify organisms into groups based on their shared…
A: A cladogram or a phylogenetic tree is a type of evolutionary tree showing representation or…
Q: Which of the following features is NOT helpful in determining the start site of a gene?…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: Which of the following is true of Generalized transduction? O creates defective virions that are…
A: Generalized Transduction: The bacteriophage first infects the donor cells and begins the lytic…
Q: You are studying a pathogenic bacterium which secretes a toxin that affects G protein receptor…
A: Since the cAMP levels are rising post the exposure to the toxin, it means that the adenyl cyclase…
Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…
A: Tunicates are transparent or brilliantly colored marine animals that are found on the dock pilings,…
Q: Classification of organisms in the three domains is based on: Cell wall. Nutritional type Cell type…
A: Three Domain System: Carl Woese et al. introduced the three-domain system in 1990, which divides…
Q: Theoretical and Actual Growth of E.coli bacteria Time Generation Hours Minutes 1 2 3 4 LO 5 6 7 0 0…
A: Introduction The term "population" usually refers to the number of people living in a specific area,…
Q: Describe the behavioural and physiological adaptations that enable many rodents to thrive in arid…
A: Introduction "Adaptation is a physical or behavioural trait of an organism that aids in the…
Q: Elaborate the pros and cons of using commercial or synthetic plant hormones.
A: Advantage: Synthetic hormone like auxin can do same function as the natural auxine do. In low…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: ou count 54 colonies of bacteria on an agarp late on which you spread 0.2ml of a 10^-4 (or 1/10,000)…
A: Given information No. of colonies= 54 Volume = 0.2 ml Dilution = 1/10000
Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…
A: Answer :- Option (C) is correct. - Insulin receptor phosphorylation increases insulin secretion.
Q: in 250 words and in own words Explain the role of the components of a spinal reflex arc.250 words…
A: A reflex arc is defined as a neural pathway that controls a reflex. The usual pathway would have…
Q: Name five (5) common, popular, familiar Philippine plants that are used as ingredients in cosmetics.…
A:
Q: produce a diagram of the replication of a viral genome of stranded RNA simple [+] and mRNA…
A: According to the answering guidelines, I'm going answer 1st three parts of the question. Please post…
Q: Describe and explain the major steps in the process ofwastewater treatment. How can artificially…
A: Introduction :- Wastewater treatment is the process of removing contaminants from wastewater and…
Q: A Cell-to-cell transmission > (Relative, %) C Infection (RLU x10³) E Infection (RLU x104) G 1.51 1.0…
A: SARS-CoV-2 transmission mediates as cell to cell transmission. It has higher efficiency than…
Q: Upon what principle does bactofugation depend? Why might its use be desirable in processing milk…
A: Bactofugation is a centrifugal method for eliminating microbe spores from milk, particularly when…
Q: Which 2 systems work together to bring in and deliver oxygen to the cells and get rid of carbon…
A: Introduction :- The circulatory system transports wastes and supplies oxygen and nutrients to cells.…
Q: Short Answer 4. You identify two recessive mutations in fruit flies, one that results in curly wings…
A: The chi square (x2) analysis is perform to compare the observed data with expected data. In…
Q: Please state the step-by-step procedure of SMEAR PREPARATION? (please explain it thoroughly in a…
A: The preparation of a smear is required for various lab procedures, including the Gram-stain. The…
Q: A loss of function mutation in both alleles of the Bcl2 gene A loss-of-function mutation in both…
A: For the cell to evade apoptotic pathways, they need to get rid of things which kill the cell as is…
Q: Go-Bags are used primarily during natural disasters. Can you give some situations a Go-Bag would…
A: Introduction A go-bag is a bag filled with necessary supplies that can be used in the event of a…
Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…
A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…
Q: 8 2 m
A: The given diagram present the developmental stages of mammalian ovary . Follicle to carpus leuteum…
Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…
A: Sequencing It is a method through which the complete genetic makeup of the organism is identified.…
Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…
A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…
Q: Briefly explain the generation and conduction of nerve impulse.
A: Introduction The nervous system is one such system that regulates and organises the entire body's…
Q: When the alary muscles contract, the hemolymph is forced through the aorta into the head. Upon…
A: Insects belong to the phylum Arthropoda. These groups have an open circulatory system. Open…
Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…
A: Population density can be calculated by three different methods they are arithmetic, physiological…
Q: Briefly explain the generation and conduction of nerve impulse.
A: Introduction Neurons:- It is the structural and functional units of the nervous system of humans…
Step by step
Solved in 2 steps
- 1. Why do you think it is necessary for there to be variation in a population in order for evolution by natural selection to occur? 2. Why is it necessary for traits to be inherited for evolution to take place? 3. If a population is already well adapted to its environment, will most mutations be helpful or harmful? Explain.5. Tay-Sachs disease is caused by a recessive allele. The frequency of this allele is 0.1 in a population of 3600 people. What is the frequency of the dominant allele, and how many of the 3600 people will be heterozygous for the condition? 6. In a population the homozygous dominant individuals made up 70% of the population, while heterozygous ones made up 21%, and recessive made up 9%. What are the frequencies of the A and a alleles? 7. In a population of 3000 fruit flies, 270 of them contain white eyes. White eye color is a recessive trait. What are the allelic frequencies for the red eye allele and white eye allele? What percent of the population will be heterozygous red? What would be the number of red eyed flies?7. In a study of a Native tribe in North America, researchers found 26 albino individuals in a population of 6000. The type of albinism found is controlled by a single gene with just two alleles, and albinism is recessive to normal skin coloration. a. Assuming Hardy-Weinberg Equilibrium, what is the frequency of the allele for albinism in this population? b. What is the frequency of carriers of the albinism allele (i.e., heterozygous) in this population, again assuming Hardy-Weinberg Equilibrium?
- 6. Interpreting Data The figure below shows the frequency of foot phenotypes in a population of blue-footed boobies. What is the frequency of the w allele in this population? a) 0.2 b) 0.4 Phenotypes c) 0.5 Genotypes ww Ww ww d) 0.6 Number of animals (total = 500) 320 160 20 © 2018 Pearson Education, Inc. 7. Interpreting Data The figure below shows the frequency of foot phenotypes in a population of blue-footed boobies. What is the expected frequency of the WW genotype in this population assuming the population is in Hardy-Weinberg equilibrium? (Hint: The frequency of W is 0.5 and the frequency of w is 0.5.) a) 0.20 Phenotypes b) 0.25 c) 0.40 Genotypes ww Ww w d) 0.50 Number of animals (total = 500) 320 160 20 © 2018 Pearson Education, Inc. 8. Interpreting Data The figure below shows the frequency of foot phenotypes in a population of blue-footed boobies. Is this population in Hardy- Weinberg equilibrium? а) yes b) no Phenotypes Genotypes Ww ww Number of animals 320 160 20 (total =…1. What happened to observed allele frequencies in each population? (only answer this question number 1, below is a data) Data: a. observed frequency of alleles of F1 population without natural selection: A=0.43 a=0.57 b.observed frequency of alleles of F2 population without natural selection: A=0.52 a=0.48 c. observed frequency of alleles of F1 population with natural selection: A=0.69 a=0.31 d. observed frequency of alleles of F2 population with natural selection: A=0.62 a=0.3812. Which can bring new traits to a population and why? 1. natural selection - because it increases the frequency of adaptive alleles in a population over time 2. natural selection and mutation because both increase the frequency of adaptive alleles in a population over time 3. mutation - because it increases the frequency of adaptive alleles in a population over time 4. natural selection and mutation because both make new alleles 5. natural selection - because it makes new alleles 6. mutation - because it makes new alleles
- 8. A hypothetical population of 100,000 humans has 68,240 individuals with the blood type AA, 28,735 individuals with blood type AB and 3025 individuals with the blood type BB. a. What is the frequency of each genotype in this population? b. What is the frequency of the A allele? c. What is the frequency B allele? d. If the next generation contained 250,000 individuals, how many individuals would have blood type BB, assuming the population is in Hardy-Weinberg equilibrium?4. In monkeys, black coat color (B) is dominant over brown color (b). A population of monkeys was found to be composed of 67 brown coated individuals and 119 black coated individuals. a. What is the frequency of the b allele in this population? b. What is the frequency of the B allele in this population? c. Based upon the Hardy-Weinberg formula, what proportion of the population is expected to have the genotype BB? d. Based upon the Hardy-Weinberg formula, what proportion of the population is expected to bave black coat color? e. Based upon the Hardy-Weinberg formula, how many individuals in this population would be expected to have the genotype Bb?4. In monkeys, black coat color (B) is dominant over brown color (b). A population of monkeys was found to be composed of 67 brown coated individuals and 119 black coated individuals. a. What is the frequency of the b allele in this population? b. What is the frequency of the B allele in this population? c. Based upon the Hardy-Weinberg formula, what proportion of the population is expected to have the genotype BB? d. Based upon the Hardy-Weinberg formula, what proportion of the population is expected to bave black coat color? e. Based upon the Hardy-Weinberg formula, how many individuals in this population would be expected to have the genotype Bb? Submit answers to question 4.
- Population genetics is the study of: how selective forces change the allele frequencies in a population over time the genetic basis of population-wide traits whether traits have a genetic basis the degree of inbreeding in a population3. In a given population, only the "A" and "B" alleles are present in the ABO system; there are no individuals with type "O" blood or with O alleles in this particular population. If 200 people have type A blood, 75 have type AB blood, and 25 have type B blood, what are the alleleic frequencies of this population (i.e., what are p and q)?1. Definitions of phenotype, genotype, allele, gene, microevolution, macroevolution 2. Know that in humans, most of the genetic variation is observed within populations, and know why that is. 3. Know the 4 processes of evolution (3 neutral + natural selection) 4. Know that evolution isn't progressive and doesn't necessarily lead to more complexity 5. Know that evolution can lead to traits that decrease survival (ex: sexual selection)