2.1 In C programming, you'll often have to deal with the scope of a variable which determinewhether or not you can access and modify it inside a specific block of code. Answer thefollowing questions by referring to Figure Q.1.}#include double M = 9.81%;int C = 3;void Cal_Z_Function ()float z = M * C* c;printf("z = %.3f\n", z);int main()}{int i;}for (i = 1; i < 10; i++)if (i%3 == 0){printf("z = %d\n",z);int z = i-M;}else if (i%3 == 1){}elsedouble z = i+M;printf("z = %.2f\n", z);return 0;Cal_Z_Function();Figure Q.1(a) Identify all variables and categorize them into either global or local variables.(b) Determine the printed z values on the user screen if i = 2, 4, 9.

A variable declared within a function or a block of code is called a local variable. Local variables…

Answered: 2.1 In C programming, you'll often have…

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

In C++, When an array is passed to a function as a pointer, the function doesn't know the size of the array. List 3 ways to handle this problem.
C++ Write a void function that has two parameters: a value parameter called num that receives a floating point number from the calling function and a floating point reference parameter called result. The functions should do this calculation: 25.0 * num + 37 and store the answer in result. Do not do any read or write operations in the function.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
need help in C++ Problem: You are asked to create a program for storing the catalog of movies at a DVD store using functions, files, and user-defined structures. The program should let the user read the movie through the file, add, remove, and output movies to the file. For this assignment, you must store the information about the movies in the catalog using a single vector. The vector's data type is a user-defined structure that you must define on functions.h following these rules: Identifier for the user-define structure: movie. Member variables of the structure "movie": name (string), year (int), and genre (string). Note: you must use the identifiers presented before when defining the user-defined structure. Your solution will NOT pass the unit test cases if you do not follow the instructions presented above. The main function is provided (you need to modify the code of the main function to call the user-defined functions described below). The following user-defined functions are…
Programming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…
Using C++ Language Write a function call with arguments tensPlace, onesPlace, and userInt. Be sure to pass the first two arguments as pointers. Sample output for the given program: tensPlace = 4, onesPlace = 1 Code: #include <stdio.h> void SplitIntoTensOnes(int* tensDigit, int* onesDigit, int DecVal){ *tensDigit = (DecVal / 10) % 10; *onesDigit = DecVal % 10;} int main(void) { int tensPlace; int onesPlace; int userInt; scanf("%d", &userInt); /* Your solution goes here */ printf("tensPlace = %d, onesPlace = %d\n", tensPlace, onesPlace); return 0;}
Consider the function definition: void GetNums(int howMany, float& alpha, float& beta) { int i; beta = 0; for (i = 0; i < howMany; i++) { beta = alpha + beta; } } Describe what happens in MEMORY when the GetNums function is called.

Recommended textbooks for you

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

Database System Concepts

Computer Science

ISBN:

9780078022159

Author:

Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:

McGraw-Hill Education

Starting Out with Python (4th Edition)

Computer Science

ISBN:

9780134444321

Author:

Tony Gaddis

Publisher:

PEARSON

Digital Fundamentals (11th Edition)

Computer Science

ISBN:

9780132737968

Author:

Thomas L. Floyd

Publisher:

PEARSON

C How to Program (8th Edition)

Computer Science

ISBN:

9780133976892

Author:

Paul J. Deitel, Harvey Deitel

Publisher:

PEARSON

Database Systems: Design, Implementation, & Manag…

Computer Science

ISBN:

9781337627900

Author:

Carlos Coronel, Steven Morris

Publisher:

Cengage Learning

Programmable Logic Controllers

Computer Science

ISBN:

9780073373843

Author:

Frank D. Petruzella

Publisher:

McGraw-Hill Education

SEE MORE TEXTBOOKS