2. Modify the MEME algorithm to identify motifs in k sequences when the number of motif instances in each sequence is specified explicitly.
Q: Calculate the amount of heat needed to melt 98.7 g of ice (H2O) and bring it to a temperature of…
A: Step 1:
Q: 9. What is sphingosine? For lipids with a sphingosine backbone, to what carbons are the other…
A: The explanation in each question are also included in the answer. Thank you.
Q: Which of the following molecules may be metabolized to provide the energy but not the carbon…
A: To determine which of the listed molecules can be metabolized to provide energy but not the carbon…
Q: Q5. Which of the following molecules best fits the following NMR spectrum? C6H12O2 8 O 5 4 ppm O OH
A: 
Q: Consider the tripeptide serylalanylleucine. Part: 0 / 2 Part 1 of 2 Draw the structure of this…
A: Please give me helpful rate.thank you
Q: Helpp 2
A: To determine whether the optimal mixed alignment with global end in both sequences A and B is…
Q: help 15.3
A: Alanine is one of the 20 standard amino acids, classified as a non-essential amino acid because…
Q: What is the approximate diameter of double helix of DNA? A. 2000 pm B. 3400 pm C. 800 pm D.…
A: Detailed explanation: Option A is CORRECT. DNA molecule has a diameter of 2000 pm.diameter is the…
Q: Choose any amino acid and show how it changes in pH and, will it modify the change distribution of…
A: Summary of Charge Changes:At low pH, serine is positively charged (+1)At intermediate pH (around…
Q: When 177. g of glycine (C₂H, NO₂). point of pure X. On the other hand, when 177. g of ammonium…
A: Approach to solving the question:Rational Detailed explanation:To solve this problem, we need to…
Q: I need help on Part B
A: Detailed explaination:1. Starting Compound (8-oxo-G):8-oxo-G (8-oxo-7,8-dihydroguanine) is a…
Q: Please explain all questions thoroughly step by step (12,13,&14)
A: Answer 1:Answer 2: Answer 3:
Q: Consider the reaction coordinate diagram shown below. Which of the following are true? (Pick two.) -…
A: We know energy change in a reaction can be calculated as difference between energy of product to the…
Q: how to do easily in simple terms
A: To modify the phylogenetic footprinting algorithm as described in the image, you will need to…
Q: © Macmillan Learning Classify each amino acid as polar neutral, hydrophobic, positively charged, or…
A: To classify each amino acid based on the categories provided:Polar Neutral:Thr (Threonine): The…
Q: (11) What is the molar concentration of a solution prepared by diluting 21mL of 5.2 M HNO3 to 0.50L?
A: Step 1:A solution's molar concentration, or molarity, will decrease as its volume increases. In…
Q: What is the major organic product obtained from the following reaction? 1 2 4 3 OH OH 2 Δ OH OH fron…
A:
Q: Hemp oil contains eicosenoic acid (20:149) as its primary monounsaturated fatty acid. Let's consider…
A: Approach to solving the question: Detailed explanation:1.β-Oxidation Products and ATP Required for…
Q: Draw the skeletal structure of a triacylglycerol that contains three molecules of caprylic acid.…
A: Step 1: Triacylglycerols (Triglycerides) Esters of glycerol and three fatty acids. They are the main…
Q: Draw the skeletal structure of a triacylglycerol that contains three molecules of capric acid. Note:…
A: Step 1:Triglycerides are esters composed of three fatty acids joined to a glycerol molecule. The…
Q: Draw the major organic product of the following reaction. H CH3CHI (excess) Draw the structure of…
A:
Q: help how to do, in simple terms please
A: Key Terms ExplainedMotif: Motif in bioinformatics has a definition that is the recurring sequence…
Q: Please help me solve 2. Explain the process in detail
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: can i get it drawn please?
A: The graph depicts the relationship between retention time and molecular weight. As retention time…
Q: Label each monosaccharide as an α or ẞ isomer. Select the single best answer for each part. Part 1…
A: Since the Fischer Projection of any given carbohydrate is always the same, the Haworth Projection is…
Q: What is the net yield of ATP when 2 molecules of pyruvate are completely oxidized? (enter numerical…
A: The net yield when 2 molecules of pyruvate are completely oxidized is 20 ATP. When 2 molecules of…
Q: Draw the structure of the a-keto acid formed by removal of the amino group during the catabolism of…
A: Here is a description of the structure for α-ketoisocaproate (4-methyl-2-oxopentanoate):Carbon…
Q: A gas balloon has a volume of 82.28 liters when the temperature is 40.9 °C and the pressure is 799.3…
A: The first step is to convert the temperatures from Celsius to Kelvin because the gas laws are based…
Q: Q6. Predict the number of signals and the splitting pattern of each signal in the 1H-NMR spectrum of…
A: The number of signals represents the number of chemically different protons (or hydrogens).The…
Q: The hydrolysis of ATP has a large negative Delta G under standard conditions, but ATP is still…
A: Let's analyze each option to understand why this is the correct answer and why the others are not:A)…
Q: K₁ = α [H+][A-] [HA] [A-] pH = pK+log [HA] 1-1 The Amino acid Arginine ionizes according to the…
A: The isoelectric point (pI) is the pH at which a particular molecule or surface carries no net…
Q: Which of the following statements is true regarding the M13 virus coat protein? (Refer to the…
A: First option: This option is incorrect because the beginning of the chain, which has negatively…
Q: It's 1 question
A: First, we need to understand the metabolic pathways involved in this scenario. Anaerobic exercise…
Q: You may have heard that chronic stress is the “silent killer.” The effects of stress can wreak havoc…
A: Stressors are events or conditions in your surroundings that may trigger stress. Your body responds…
Q: What is the net yield of ATP when 2 molecules of pyruvate are completely oxidized? (enter numerical…
A: The oxidation of pyruvate occurs in several steps, primarily within the mitochondria of eukaryotic…
Q: Skeletal muscle cells (myocytes) store energy by synthesizing ____________ when blood sugar is…
A: The correct answer is:glycogen; highWhen blood sugar (glucose) levels are high, skeletal muscle…
Q: A 160 residue polytopic integral plasma membrane protein has the following sequence at its…
A: Step 1:To predict the overall tertiary structure of the 160-residue polytopic integral plasma…
Q: Disorders associated with and epigenetic defect resulting in decreased protein expression should be…
A: The use of molecular tests for diagnosing disorders associated with epigenetic defects resulting in…
Q: Please step by step answer and don't use ASI Answer please
A: Step 1:Step 2:Step 3:
Q: Draw the major product of the following Sonogashira coupling reaction. [Pd], pyrrolidine, TBAB + =Ph…
A: 1. Di-coupling reaction will happen here. 2. Olefin Metathesis Reaction:See all possible Four…
Q: Can you help me understand the mech
A: Step 1:Step 2: Step 3:
Q: Please help me solve 3 and explain the process in order to understand.
A: Conclusion: Anfinsen's experiment demonstrated that the amino acid sequence of a protein…
Q: Draw the structure of the a-keto acid formed by removal of the amino group during the catabolism of…
A: So, the structure of the α-keto acid after deamination of cysteine is 3-sulfanylpyruvate:…
Q: The homogeneity of the chloride level in a water sample from a lake was tested by analyzing portions…
A:
Q: Please help with part 4
A: Step 1: Identify the type of monosaccharide: The first molecule has an aldehyde group (CHO) at the…
Q: 19. (a) Use Figure 1 to draw the cyclic ẞ-form of the monosaccharide shown below. CHO CH₂OH HO-CH…
A: 19 a) To draw the cyclic β-form of the monosaccharide shown in Figure 1, follow these steps: Draw…
Q: 9. (1 pt) What is the [H+] and [OH-] for the following strong acid and strong base solutions: A)…
A: Step 1: Strong acids completely dissociate in water, so they give the concentration of [H+]…
Q: Ramipril is an ACE inhibitor that contains an ester, amide, and other functional groups. Part: 0/2…
A: Answer:Ester is formed via condensation of an alcohol and carboxylic acid. Therefore, ester contains…
Q: suppose the same experiment was done using the mixture of tube 2 of this experiment( as described…
A:
Q: 1. Refer to Model 2 for information relevant to this question a) A sample of the peptide Lys-Glu-Ser…
A: Detailed explanation: 1a) A sample of the peptide Lys-Glu-Ser has a net charge of zero between…
help please, how to do in simple terms
Step by step
Solved in 2 steps
- 1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Sera. What sequence of fi ve amino acids would give a 14-merprobe with the least degeneracy for probing a library tofi nd your gene of interest? Notice that you do not use thelast base in the fi fth codon because of its degeneracy.b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly?c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.4. Define the planted motif search problem.1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?
- 8. Given the following two sequences, create a pairwise alignment by hand. Do not place any gaps in the sequences to optimize alignment. Use an identity matrix and BLOSUM62 substitution matrix to create the two sets of pairwise alignments. Report the identity, identity score, similarity, and similarity score.Sequence 1: ATPL MSequence 2: ATKI M3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).2. A single base addition and a single base deletion approximately 15 bases apart in the MRNA specifying the protein lysozyme for the bacterial virus T4 caused a change in the protein from its normal composition: Lys – Ser - Pro - Ser - Leu- Asn-Ala - Ala - Lys To the mutant form: Lys - Val - His- His - Leu - Met- Ala-Ala- Lys a. From the genetic code, decipher the sequence of mRNA for both original protein and double mutant. b. Which base was added? Which base was deleted? · END -
- 1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Ser a. What sequence of five amino acids would give a 14-merprobe with the least degeneracy for probing a library tofind your gene of interest? Notice that you do not use thelast base in the fifth codon because of its degeneracy. b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly? c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.7. Consider the 3 mechanisms of HGT in prokaryotes and identify 1) which one leads to the presence of a spacer in the CRISPR locus of a bacterial chromosome and 2) describe how this HGT mechanism occurs. Hint: in 2) the question asks to describe the HGT mechanism, not how the spacer is incorporated into the bacterial chromosome by Cas proteins. The HGT mechanism that leads to a spacer in a bacterial chromosome is During this mechanism3. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b. Transcribe Translate C. 5'- CAAATTAATGGCGGCATTTACGATGGTGGGATCATTACATTGACTAACG -3' 1 5 3'- GTTTAATTACCGCCGTAAATGCTACCACCCTAGTAATGTAACTGATTGC -5′ -+- -+--- --+−−· ---+--
- 6. Examine the following coding strand DNA nucleotide sequence,^representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). d. Give the sequence of the first 10 nucleotides of the mRNA transcript 5' to 3'. a. b. С.solve given problem23. Design the forward, reverse, and internal primers to the gene below and mutate the bolded/underlined histidine (CAC) to an alanine (GCC). Primers are usually 18-25 nucleotides long, but only make primers 9 nucleotides long to save work. 5'-ATGGATCGATACGGACGAAATCACCTACCGAATCAGGCGTGACGTGA-3' External Forward: External Reverse: Internal Forward: Internal Reverse: