2. Analyze the following code:public class Test {public static void main (String[] args) {int[] x = {0, 1, 2, 3, 4, 5);xMethod(x, 5);}public static void xMethod(int[] x, int length) {for (int i = 0; i < length; i++)System.out.print(" " + x[i]);}}a. The program displays 0 1 2 3 4.b. The program displays 0 1 2 3 4 and then raises a runtime exception.c. The program displays 0 1 2 3 4 5.d. The program displays 0 1 2 3 4 5 and then raises a runtime exception.e. There is a syntax error in the declaration of xMethod

**Initialize an array x with values {0, 1, 2, 3, 4, 5}.Call a method named xMethod with the array x…

Answered: 2. Analyze the following code:

Engineering

Computer Science

2. Analyze the following code:

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: Part 1: Write a program that uses a 2-D array to store the highest and lowest temperatures for each…

A: NOTE: Since programming language is not mentioned. Therefore answering the question in Python…

Q: Functions You have probably noticed that if you try to read into an int variable using scanf but…

A: Find the required code given as below and output:

Q: implement following funtions: std::vector> return_table(int number_of_vars);…

A: Hello there, Assuming that every variable has 2 values. You want to implement a function that first…

Q: What is the output of the code below? def mystery_func(input, num, t = 0, x = 10, y = 10) [this…

A: Solution :

Q: 2) Let array a be 549,813120,6) and b be the last digit of your student mumber Accordingly, if we…

A: Create a main() method, initialize the variable array a with the specified values, and then create…

Q: Rectangle boxl = new Rectangle(5, 10); Rectangle box2 = box1; Rectangle box3 = new Rectangle (5,…

A: Define a package testRectangle; Define a class Rectangle. Define variables length and width. Define…

Q: The language we are using here is in Racket. Please enter the following code: (cond ((equal? 16…

A: 1) The return value of above code is 18. 2) When we replace all the 16s in the above code with 8 the…

Q: Using C++ Write the section of code which takes an array of characters and copies it to another…

A: The question is to write the code for the provided scenario.

Q: ive the F4 function of the following generated design:

A: Let see solution

Q: matrix of 0s and 1s) Write a function that displays an n-by-n matrix using the following header:…

A: Code: from random import randintdef printMatrix(n): for x in range(n): for y in range(n):…

Q: I need to write the following code taking entera from the user.

A: The answer to thee following question:-

Q: 1. Prompts the user for the parameters of the model: a, B, 7, 8 o If a user inputs a negative value…

A: Note :- You have not mention the language of the program so I'm answering your question in C++.Your…

Q: What is the output of the following code?

A: The ostream class is represented by the C++ cout expression. It's utilized to generate output for…

Q: What is the purpose of the following statement?

A: A purpose statement, also known as a "position statement," is a sentence that outlines a company's…

Q: Write a C program that implements and tests a function that simulates strcmp function. You should…

A: Introduction Dennis Ritchie developed the computer based language C at At&t Bell labs in 1972.…

Q: (b) This code has a problem. What is it? How is it called? double x = 1.5, y = 3.4; double* p =…

A: The given code is a C++ code snippet that contains some operations involving pointers and dynamic…

Q: Show the output of the following code:

A: a> ans: Program a after execution ,its output will be null. Because we have given amount=5;…

Q: /* in the worst case scenario: what is the value of count for an input value of 'n'? */ public…

A: Here in this question we have given a code segment and we have asked to find the time complexity of…

Q: AND SHOW COMMENTS TO EXPLAIN CODE A confused Dutchman trying to speak English could say “I am in…

A: the code is an given below

Q: Assume the parameters in the following code are being passed by reference. What numbers reside in…

A: Pass by reference: Any changes made in the formal arguments will be reflected back to actual…

Q: This is array1 253 254 255 This is array2 00001000

A: It is defined as a low-level programming language for a computer or other programmable device…

Q: ['ab', 'cd'] for i in x: x.append (i.upper()) O [ab', 'cd'] O l'ab', 'cd', 'AB', 'CD'] O None of…

A: According to the Question below the Solution:

Q: • frame: takes in a short sentence (string with words separated by spaces) and returns a string that…

A: Algorithm: Start Read a string s Implement a method frame() which takes string s as argument…

Q: Help me write code for the scale down function please, make sure the size of the block can't become…

A: Algorithm scaleDown(): 1. If the current size (this.size) is greater than 2: 2. Calculate the…

Q: Enter the radius: The radius: 5.0 Enter the radius: The radius: 5.0 The circle circumference:…

A: According to the information given:- We have to fix the sphere volume value...

Q: What is the problem in this code?

A: I am not able to see the database, but do check the column names are matching or not. Since there is…

Q: Create a text file with following data to test your code. Please use array of structure and try to…

A: #include <iostream> #include <fstream> //for file operations #include <iomanip>…

Q: XOR AX, AX ADD AX,1 NOT AX NEG AX

A: Given code XOR AX ,AX ADD AX, 1 NOT AX NEG AX

Q: 4: Signing a Message generate a signature for the following message (please directly sign this…

A: #include <stdio.h> #include <openssl/bn.h> #define NBITS 256 void printBN(char…

Q: Given the following declaration: nums - { 7 : 12, 4 : 11, 11 : 8 } What is the value of the…

A: In the above question, the dictionary of the number named nums is given. Code : nums =…

Q: Check test scores) The answers to a true-false test are as follows: T T F F T. Given a…

A: According to the Question below the Complete Solution: Program Output:

Q: Please show the output of the code!

A: Given, We have to provide the output of the given code, Code: #include <stdio.h> union…

Q: censor: takes in two string arguments (first argument is the message, second argument is the word…

A: Censor : Here is the answer with code Python3. Mentioned below code and Screenshot of the Same Code…

Q: def reverse(array): for i in range(0, int(len(array)/2)): other= len(array)-i-1 temp = array[i]…

A: Given code contains reverse() function which takes array as input. Then it contains a for loop which…

Q: s='CTCACAGCTTGAACGGCTGTG'; a=regexp (s, '(..) AA', 'tokens', 'once'); disp (a{1}) (A) A (G) AG (M)…

A: We need to find the output of the given Matlab code.

Q: Q2) Write and test the following power() function that returns x raised to the power n, where n can…

A: C++ Code for Above : #include <bits/stdc++.h> using namespace std; //power function double…

Q: (python) 9. Create a function based on the following information: You are given two strings with…

A: GIVEN: (python) 9. Create a function based on the following information: You are given two strings…

Question

2. Analyze the following code:
public class Test {
public static void main (String[] args) {
int[] x = {0, 1, 2, 3, 4, 5);
xMethod(x, 5);
}
public static void xMethod
(int[] x, int length) {
for (int i = 0; i < length; i++)
System.out.print(" " + x[i]);
}
}
a. The program displays 0 1 2 3 4.
b. The program displays 0 1 2 3 4 and then raises a runtime exception.
c. The program displays 0 1 2 3 4 5.
d. The program displays 0 1 2 3 4 5 and then raises a runtime exception.
e. There is a syntax error in the declaration of xMethod

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Algorithm

VIEW

Step 2: Code and Explanation

VIEW

Step 3: Code Screenshot

VIEW

Solution

VIEW

Step by step

Solved in 4 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

List out the errors in the following code?
find and fix error in this code
(True/False): A segment descriptor contains the base location of a segment.
Implement the following function: Code should be written in python.
[Python (py3)] The error in the code below is if the number of rows of the matrix is not equal to its number of columns, matrix addition will not be performed. This should not be the case since the only requirement for matrices addition is that the dimension of Matrix A is equal to the dimension of Matrix B. Please resolve the error in the code below such that Matrix A and Matrix B can be added if the dimension of Matrix A is equal to the dimension of Matrix B. PLEASE do not just copy the code below and use it as the answer itself. I've encountered such case many times. Please modify the code. When the dimension of Matrix A is not equal to the dimension of Matrix B, print "Matrix addition cannot be performed; dimensions are unequal." The input will come from file1.txt, and the output should only be printed to output.txt Format of the input from file1.txt:First Line: type of operation (add)Second Line: matrix A dimension (example: if 3 rows and 2 columns, type 3 2)Third Line: matrix A…
What is the output of the following code?
I'm getting this error for the above code
Use Type Switches and Asertions sparingly function to write go code. Question is right , please donot reject it Output 70< nil>
(Using Python)Write a function that returns a new list by eliminating theduplicate values in the list. Use the following function header:def eliminateDuplicates(lst):Write a test program that reads in a list of integers, invokes the function,and displays the result. Here is the sample run of the program Enter ten numbers: 2 3 2 1 6 3 4 5 2The distinct numbers are: 1 2 3 6 4 5
What is the output of the following code ?
[Updated[ Python Code Pt1: Algorithms and Data Structures Please use the sample input to see if the code works, as the output of the final code, must be the same as the correct output. Follow the details and notes provided and show the complete working sample code. Additionally, include comments to make the code easier to understand. I will show how the output was found (check K);Note: The final code should result in correct output (check I) if sample input A (check H) is used, or else I will give an automatic thumbs down A. TASKThe user inputs a path system and the work needed to traverse them. The goal is to Identify the relationships between paths, whether they have sequential, adjacent, or null relationships. For every sequential and adjacent relationship, give their work done based on the formula (check D). B. SAMPLE A path system illustration //See Image C. Relationship Examples with Sample A as basisSequential relationships: Path1 and Path2 as they are single paths that are…