19. Which of the following is NOT true of the Embden-Meyerhof-Pamas (EMP) pathway? A. Produces a total of four ATP molecules B. Produces one pyruvate C. Produces two molecules of NADH D. The most common pathway in microbes E. Uses two ATP molecules to modify a glucose molecule V
Q: See image
A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: Answer the following “cause-effect” true/false questions using the answer key: A: Only statement A…
A: The questions inquired are related to the cause-effect relationship between two statements, each…
Q: Q4.7. A large sunflower population is established in a field. The flowers mate randomly, and all…
A: The question presents a scenario involving a large sunflower population in a field. The flowers mate…
Q: concentration. What will happen to the animal cell? Net movement of water out of the animal cell,…
A: This question is talking about a process called Osmosis. Osmosis is the process in which water or…
Q: C6H12O6
A: C6H12O6:This is a glucose molecule.It is a vital carbohydrate and primary source of energy for…
Q: TAATTGE IGGAG anog regulatory sequence en this interaction map which DNA sequence would the…
A: Transcription regulation is a mechanism in which gene expression is regulated. For this purpose…
Q: You, a hospital administrator, are confronted by a news reporter who asks about an outbreak in your…
A: Here portrayed a critical epidemic of Clostridium botulinum, an anaerobic spore-forming microbes, in…
Q: Part 1: Reproduction 1. Give an example of asexual reproduction. 2. What is a clone? 3. What is the…
A: In meiosis a single cell divides two times to produce four daughter cells, each contain half he…
Q: Name and describe 5 properties of cancerous or tumor cells from patients(in vivo) and of cancerous…
A: Cancerous cells are abnormal cells that grow uncontrollably, invade surrounding tissues, and can…
Q: Label the gross anatomy features of the stomach.
A: The human stomach is a J-shaped hollow organ. It has a thick, wrinkly lining called the mucosa. It's…
Q: Which of the following mechanisms of evolution would have the SMALLEST impact on allele frequency…
A: An allele is one of two forms of a gene. Allele frequency describes how common an allele is in a…
Q: What is the Main Point of Figure a? What is one of the main points of Figure B [Choose ] [Choose ] >
A: Heat shock protein :Heat shock proteins (HSPs) are a class of proteins produced by cells in response…
Q: 1 Look at Figure 7.10 and distinguish the characteristics of an older versus a younger pubic…
A: Left and right pelvic bones gused to form a joint called punic symphysis. In females it helps in the…
Q: A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pl, bk,…
A: The scenario presented involves an exploration of genetics using Drosophila or fruit flies. In this…
Q: 5) Fernando has type O blood and Darla has type A. Darla's brother has type O, while both of her…
A: Blood group refers to the type of antigen carried on the Red Blood Cells. In humans there, are two…
Q: The picture below shows ungulates gathering under a tree during the heat of the day. In the morning…
A: The process of adjusting and adapting the change to the natural environment is called adaptation.…
Q: Show an example of Robertsonian Translocation using letters
A: Robertsonian translocation is a type of chromosomal rearrangement where the long arms of two…
Q: In meiosis, we talk about the daughter cells having half the chromosomes of the parent cell. Choose…
A: Meiosis : in this type of division a parent cell is divided into four genetically different…
Q: Q4.6. Imagine a species whose eye color is determined by a receptor molecule called EyeC. When EyeC…
A: The question presents a hypothetical scenario about a species whose eye color is determined by a…
Q: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
A: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
Q: 1. What does the enzyme bind to in order to carry out its reaction? 2. Where on the enzyme does the…
A: The protein that acts as biological catalyst with the help of chemical reactions is known as…
Q: ✓ lipids fatty acid v cholesterol emulsifier sterols polyunsaturated fatty acid v bile saturated…
A: This worksheet is about fat related terms. Fat comprisers of oils,fatty acids, steroids, waxes,…
Q: Zygote Cleavage (Blastula) Cleavage (8-cell stage) Early Gastrula
A: The development of an organism begins after the fertilization process. Fertilization involves fusion…
Q: The image attached is a drawing of a Columnar Epithelium slide with the 40x objective lens. There…
A: The lining of the digestive tract (stomach, small intestine, and large intestine), the respiratory…
Q: code for Radiopharmaceutical therapy by intravenous administration
A: When the drugs are administrated into the body system of an individual by directly releasing them…
Q: How many steps are there in these metabolic pathways? 1. Glycolysis 2. Pyruvate Oxidation 3. Kreb's…
A: Glycolysis consists of 10 steps in total. There are two main phases. Out of the 10 steps, 7 are…
Q: Which of the below options are what actually cause the fitness differences that natural selection…
A: In the natural world, the process of evolution unfolds through mechanisms like natural selection.…
Q: What is the best description for the following tissues (Explain in 1-3 sentences): Description: 1.…
A: One of the four primary forms of bodily tissue, epithelial tissue covers both internal and exterior…
Q: Describe the process of transpiration in detail. How does water move from the roots to the leaves of…
A: Transpiration is a physiological phenomenon in which water is conveyed from the plant's roots to its…
Q: 2 What is the pathophysiology of trauma?
A: Trauma, in the context of medicine, refers to physical injuries or wounds caused by external forces.…
Q: A solution is made using 1 mL of serum and 4 mLs of normal saline. Fill in the chart: a. Serum to…
A: Dilutions are laboratory processes where a quantity of one material is added to another to lower the…
Q: The tryptophan operator a) is an allosteric protein. b) binds to the tryptophan repressor when the…
A: What is an Operon ?The expression of a gene is controlled by the control of rate of transcriptional…
Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…
A: Chromosomal aberration - It is defined as the change in chromosome structure and number.Change in…
Q: A lima bean contains a plant embryo that is capable of becoming a mature plant with roots, a stem,…
A: The embryo is a diploid structure formed from the fusion of haploid female and male gametes. The…
Q: Which of the following statements is FALSE? (Choose the best answer) O Neurons in the nervous system…
A: Synapses are the contact region between the axon terminal of the first neuron and dendrites of the…
Q: An organism has the chromosomes below where the letters represent genetic loci and the period…
A: Chromosome aberrations are modifications to the number or structure of chromosomes within the genome…
Q: Below is a pedigree of a human blinding disease. Use this pedigree to answer the following…
A: Pedigree is a symbolic representation of genetic inheritance of a particular traits in a family.…
Q: 1. Draw the label cardiac muscle tissue as you observed it at medium magnification. 2. Draw and…
A: Muscles contract to contribute to both gross and fine movements, enabling actions such as walking,…
Q: You discover a new bacterium. Its cell envelope shows high concentrations of phosphatidylethanolmine…
A: Bacterias are mainly classified in to two types in microbiology. They are:Gram-positive and…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: Cellular respiration involves the breakdown of glucose and the production of energy in the presence…
Q: Q4.7. In DNA replication, what is the difference between the leading and lagging strands? In the…
A: DNA replication is a mechanism through which cells make copies of the genome's DNA. A cell must…
Q: emitendinosus stylohyoid hypoglossus brachioradialis The hamstring that becomes tendinous midway…
A: Multiple muscles that are arranged into anatomical compartments constitute the upper limb. These…
Q: Using your knowledge of the central nervous system and various cell-cell interactions, identify the…
A: The central nervous system (CNS), which includes the brain and spinal cord, is an essential…
Q: Around the world, populations near to the equator and in areas of high altitude have darker skin…
A: As per our guidelines, we are supposed to answer only-One question (If there are multiple questions…
Q: Deoxyribonucleoside triphosphates are the necessary and fundamental monomers for polymerization of…
A: This question addresses why ribonucleoside triphosphates (rNTPs) are required in addition to…
Q: The highest level of transcription of the E. coli lac operon occurs when CAP (+cAMP) is bound to the…
A: The lac operon in E. coli is a system of genes that regulates the metabolism of lactose, a sugar.…
Q: QUESTION 4 What is the shape of the rete ridges in Psoriasis? O a. Flat O b. Wide plate c. Thin and…
A: Psoriasis is a skin disease that causes an itchy, scaly rash on the knees, elbows, trunk, and scalp.…
Q: bottleneck effect gene flow founder effect sexual selection 1. As habitats change, populations of…
A: Evolution is a natural process occurring continuously in nature, It involves adaptation of the…
Q: ich of the following answers are true about adenosine triphosphate (ATP)? Note, there may be MORE…
A: ATP stands for adenosine triphosphate. It is used as an energy currency in lot of metabolic…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Since you have posted multiple questions, we will provide the solution only for the first question…
Step by step
Solved in 3 steps
- 17. Which of the following chemical formula summarizes cellular respiration? Group of answer choices 6CO2 + 6O2 + light energy 6H2O + C6H12O6 6CO2 + 6H2O + light energy C6H12O6 + 6O2 C6H12O6 + 6O2 6CO2 + 6H2O + ATP C6H12O6 + 6H2O 6O2 + 6CO2 + ATPDefine the following terms:a. glyoxosomeb. coenzyme Ac. NAD(P)+d. FADe. FMNChemiosmosis involves a. the movement of electrons across the cell membrane. b. the movement of hydrogen atoms across a mitochondrial membrane. c. the movement of hydrogen ions across a mitochondrial membrane. d. the movement of glucose through the cell membrane.
- Which of the following pathways requires molecular oxygen (O2)? a. aerobic respiration b. lactate formation c. alcoholic fermentation d. photosynthesis10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12. Enzyme responsible in catalyzing a transfer of group, other than hydrogen, between a pair of substrates. 13. Coenzyme of vitamin B2, Riboflavin A. NAD or NADP B. FAD or FMN C. Coenzyme A D. Thiamine pyrophosphate 14.Catalyzing interconversion of optic, geometric or positional isomers. 15. Catalyzing removal of groups from substrates by mechanisms other than hydrolysis, leaving double bonds. 16. Catalyzing linkage of 2 compounds coupled to the breaking of a pyrophosphate bond in ATP or a similar compound. 17. Aid in the hydrolysis of nucleic acids.26. Identify the correct statement that best describes about the chemiosmotic mechanism. * A. Explains about the transport of Na+ and K+ across cell membranes is by active transport. O B. Explains how transport by facilitated diffusion reaches a saturation limit. O C. A process in which proton gradient that drives the formation of ATP. O D. Explains about cytochromes which phosphorylate ADP to form ATP. 27 When oygen is present, determine the number of ATP yield per glucose
- 11. Refer to the figure below. нн Н `NH2 NH2 N' N- 2e-+H* R NAD+ NADH NAD+ functions as a coenzyme in many enzyme-catalyzed reactions. The changes that take place in this coenzyme are the same for all of these reactions and are illustrated in the figure. It is likely that, in these reactions, NAD+ functions as an electron acceptor (reducing agent) in redox reactions. functions as an electron donor (oxidizing agent) in redox reactions. functions as a base in acid-base catalytic mechanisms. functions as an electron donor (oxidizing agent) in redox reactions. functions as an electron acceptor (oxidizing agent) in redox reactions. +Z-3. Listed below are four redox couples. An organotroph uses compounds from two of these to carry out anaerobic respiration. A lithotroph uses compounds from two different couples to carry out aerobic respiration. Arrange these compounds into the redox towers below, showing which compounds would be the e donors and acceptors for the two organisms, and how many moles of e would be transferred per mole of donor. Fe(OH)3/Fe +2 (E = -0.16V); SO4²/S (E = -0.25V); C₂H₂O2 /C4H6O2 (E= -0.20V); O₂/H₂O (E=0.82V) lithotroph I organotroph I Which organism would produce the most energy per mole of e donor? Show your work.Why do some microbes produce fermentation end products under anaerobic conditions? O A. to make glucose OB. to regenerate NAD* so glycolysis can continue O C. to store these products as energy sources and use them when glucose is unavailable O D. to generate ATP
- 4. Desulfovibrio africanus is an organotroph that carries out anaerobic respiration using two of the redox couples below to generate energy and reducing power. Thiobacillus denitrificans is a chemolithotroph that uses the waste product of Desulfovibrio's e transport system as a source of e, and also carries out anaerobic respiration using one more of the redox couples. Which organism would produce the most energy per mole of its e donor? Show your work. C3H4O3/C3H8O3 (-0.28 V) 0₂/H₂O (+0.82) NO2/N2 (+0.38 V) S₂O32/H₂S (-0.18 V)1. Choose all the correct answers. Enzyme catalyzing this reaction: COO CO0 но C-H + NAD* CH2 + NADH + H* CH2 лвенный тет CoO COO L-Malate Oxaloacetate A. Belongs to the class of transferases. B. Belongs to the class of oxidoreductases. C. Is a simple enzyme. D. Is a holoenzyme.How can chemolithotrophs create a membrane pH gradient if they are not using traditional proton transporters such as complex I or IlI? a. They do not create pH gradients for use by the ATP synthase. b. Oxidation of extracellular substrates creates 'holes' in the membrane allowing protons to leak. c. Oxidation of extracellular substrates utilizes H2O as the oxygen source. This produces 2H+. d. Instead of increasing proton concentration in the periplasmic space, these microorganisms neutralize protons in the cytoplasm.