15.17) How many ATP can be produced from the catabolism of one glucose molecule when the two NADH from glycolysis use the glycerol 3-phosphate shuttle? For this calculation, assume that each NADH that undergoes oxidative phosphorylation produces 2.5 ATP, and each FADH₂ produces 1.5 ATP. Stage 2: Acetyl-CoA Production Stage 3: Citric Acid Cycle Stage 4: Oxidative Phosphorylation 2 NADHK shuttle glycerol 3-phosphate 2 FADH₂ 2 FADH₂ PKL 4 FADH₂ glucose Reactions of Glycolysis 2 pyruvates pyruvate oxidation/decarboxylation 2 acetyl-coenzyme A intramembrane space Citric Acid Cycle 1.5 ATP 1 FADH₂ Oxidative Phosphorylation 2 NADH 6 NADH 2 ATP 8 NADH cytoplasm mitochondria mitochondrial matrix 2 ATP 2.5 ATP 1 NADH 2 ATP 2 ATP 20 ATP 6 ATP ANSWER: 30 ATP

Q: ER 1ZER TIZER GEL

A: Neurons or nerve cells form the structural and functional unit of the brain and spinal cord. Neurons…

Q: CENCE P

A: White blood cells are present in our blood as blood elements’ components and they protect our body…

Q: Could u pls write little longer? thanks

A: Drugs affect how neurons use neurotransmitters to send, receive, and process signals. Because some…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: Label the ear model b D E - Y - E z o E

A: The diagram is of the internal structures of left side of the ear   NERVES  COCHLEAR NERVE…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase)  Mitosis is a type of cell division in which a cell…

Q: Match the following VA V B " .. V C V D VE A. Aqueous humor B. Vitreous humor C. Cornea D. Choroid…

A: Sense organs are the structure in the body that catch up external stimuli and provide response to it…

Q: need help with a intro to respiratory questions, thanks

A: Respiration is the sequence of process that results in the exchange of oxygen and the carbon dioxide…

Q: Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to…

A: The DNA inside the cells contains all the necessary information for protein production. For the…

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…

A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…

Q: If my gay boyfriend has HIV positive that he suck my dick. Am I get a change catch HIV positive?

A: HIV stands for Human Immunodeficiency virus. It is a group of retrovirus that can infect humans. Its…

Q: I am confused what is HDI. pls define in easy words.

A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Can u answer your qustions

A: Need to find the answers the given questions below with reference to the graph.

Q: Can you help me to write the name of the label of this picture? I have a hard time to figure it out.

A: There is a pair of collar bones present in humans. Collar's bones are also known as the clavicle.…

Q: im confused, what is the answer?

A: The root system and the shoot system are the two main structures in plants. Every one of these…