/ 11 of 15 was looking at the results of a cross between red (RR) and white flowers (rr). Which is the MOST likely result of a cross that demonstrates INCOMPLETE nance? 1 0% pink flowers Rr 3 25% white flowers T E 50% red flowers RR . 100% pink flowers Rr

/ 11 of 15 was looking at the results of a cross between red (RR) and white flowers (rr). Which is the MOST likely result of a cross that demonstrates INCOMPLETE nance? 1 0% pink flowers Rr 3 25% white flowers T E 50% red flowers RR . 100% pink flowers Rr

Name: itance /11 of 15Scott was looking at the results of a cross between r
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: itance /11 of 15Scott was looking at the results of a cross between red (RR) and white flowers (rr). Which is the MOST likely result of a cross that demonstrates INCOMPLETEdominance?O A. 0% pink flowers RrOB. 25% white flowers rrO C. 50% red flowers

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter11: The Basic Principles Of Heredity

Section: Chapter Questions

Problem 3TYU: The type of cross described in question 2 is (a) an F2 cross (b) a dihybrid cross (c) a test cross...

See similar textbooks

Similar questions

Please help with number 13:)
Please answer b,c,d,e only. Thanks
T = Tall t = short pollen from a tall pea plant T T eggs from a tall pea plant T TT TT t Tt Tt In the square shown, which of the following is true about the offspring resulting from the cross? Multiple Choice a. Half are expected to be short. b. All are expected to be tall. c. All are expected to be short. d. All are expected to be of medium height.
An a cross between two true-breeding plants, Parent #1 with yellow, round peas and Parent #2 with green, wrinkled peas, 1. a. What is the genotype of each plant in the cross. What proportion of the F1 progeny will have the same phenotype as Parent #2. After you self the F1s, what proportion of the progeny will have the same phenotype as Parent #1. C. What proportion of the progeny will have the same genotype as Parent # 1. d. b.
a. 1 dominant allele will contribute 120/10 = 12 cm to the base height of the plant.b. The height of the parent plant 1 Genotype of the parent plant 1 – D1D1D2D2D3D3d4d4d5d5 The height of the parent plant 2 Genotype of the parent plant 2 – d1d1d2d2d3d3D4D4D5D5Contributing alleles – D4D4D5D5. The height of the plant without any contributing alleles would be 80 cm. The plant with genotype d1d1d2d2d3d3D4D4D5D5 has 4 contributing allele each of which contributes 12 cm to the base. Hence, the height of the plant with genotype d1d1d2d2d3d3D4D4D5D5 would be 80 + 12 + 12 + 12 + 12 = 128 cm. c. Parents – D1D1D2D2D3D3d4d4d5d5 × d1d1d2d2d3d3D4D4D5D5 Gametes – D1D2D3d4d5 × d1d2d3D4D5 F1 generation – D1d1D2d2D3d3D4d4D5d5 The height of the plants of F1 generation = 80 + 12 + 12 + 12 + 12 + 12 = 140 cm Hence, Genotype of the F1 = D1d1D2d2D3d3D4d4D5d5 Phenotype of…
For each of the terms in the left column, choose thebest matching phrase in the right column.a. phenotype 1. having two identical alleles of a given geneb. alleles 2. the allele expressed in the phenotype ofthe heterozygotec. independent 3. alternate forms of a gene assortmentd. gametes 4. observable characteristice. gene 5. a cross between individuals bothheterozygous for two genesf. segregation 6. alleles of one gene separate into gametesrandomly with respect to alleles of othergenesg. heterozygote 7. reproductive cells containing only onecopy of each geneh. dominant 8. the allele that does not contribute to thephenotype of the heterozygotei. F1 9. the cross of an individual of ambiguousgenotype with a homozygous recessiveindividualj. testcross 10. an individual with two different allelesof a genek. genotype 11. the heritable entity that determines acharacteristicl. recessive 12. the alleles an individual hasm. dihybrid cross 13. the separation of the two alleles of agene into…
Mutations Adenosine triphosphate is an energy molecule found in cells and produced as a result of cellular respiration. Many enzymes are required for cellular respiration to produce an ATP molecule. The following is an original DNA segment from a sequence that codes for the production of an enzyme necessary for the production of ATP in organisms: Original DNA: TACAAGTTTAGTACGTATATGCCAACT A mutation occurred during replication that resulted in the following change in the segment of DNA: Mutated DNA: TACAAGTTTATGTACGTATATGCCAACT 1) Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred. 2) Evaluate the the significance of this mutation. a. How does this mutation affect the production of ATP? b. How will this mutation affect this organism cellular respiration process?
The pedigree below shows the blood types of the Jones family. Review the pedigree and determine the possible genotype(s) of individual 12. AB #1 # 2 #3 24 A. AB #5 創7 #10 11 #12 #13 O a. AJA O b. Ai O c. ii O d. Only a and b are possible genotypes O e. All of these are possible genotypes
In this case a family history revealed a genetic basis for the disorder. The pedigree is shown in Fig. 1 Below. Key Ø Female: affected Female: unaffected I || IV V TOLO 5 DO 머 9 10 a. Any of these options is possible b. III.5 but not V.3 would display the disease O c. V.3 but not III.5 would display the disease O d. Neither III.5 nor V.3 would display the disease Oe. Both III.3 and V.3 would display the disease 10 ન Male: affected Male: unaffected Deceased Disease status not given Dizygotic twins Monozygotic twins Fig. 1 Disease pedigree. Five generations I, II, III, IV, V are shown. Females are represented by circles, males by squares, dizygotic (non-identical) twins by diagonal lines originating from the same point, Monozygotic (identical) twins by diagonal lines originating from the same point and joined symbols and deceased by a diagonal line through the symbol. Filled symbols indicate that the individual displays the disease phenotype. Unfilled symbols indicate that the individual…
recessive? 4.3 What percentage of the offspring will be heterozygous? Level 5-6 5. Pea plants, spherical seeds (S) are dominant to dented seeds (s). In a genetic cross of two plants that are heterozygous for the seed shape trait, a. Identify the alleles/genotypes used in this cross: used in thi
Supposing two strains of autotetraploid plants are available and their genotypes are as follows. Plant 1: AAaa - in this plant the gene is close to the centromere Plant 2: AAAa - in this plant the gene is far from the centromere The allele A for yellow stigma is completely dominant to green (aa).
Can someone please do thid question for me i dont know how to do i need help this question has 2 parts a and b Its attached below and please write answer in order so i wont be confused