10. What event could possibly take pláče A. earthquake 11. What are the indications or evidence that the crust is splitting apart? A. Formation of rift valleys and oceanic ridges B. Melting of ice at the north pole C. Occurrence of tsunami D. Presence of Mountain Ranges 12. What is another term used to describe rift valleys? A down faulted valleys C. jagged mountains B. volcanic eruption C. Tremor D. Tsunami B. fault-block D. submarine valleys

Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…

A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…

Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…

A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…

Q: when you're done, use the answer key to check and revise your work. braw a line from each statement…

A: A cell is the basic or fundamental unit of any life form. Living organisms are broadly classified…

Q: From the choices below, which are reputable sites that can be used to locate scientific journal…

A: Science is a term which is used for the study of the subject which is based on the facts and…

Q: Part 1: Graphing Biotic Potential 1. Make a table to show the data (# flies/generation). for one…

A: Given that one female fly can produce 120 eggs in one generation. Of these 120 eggs, half (60) will…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: If you were to choose a material for soft tissue, what would be your immediate choice? metals…

A: The tissues that are mainly present in the muscles, ligaments, and tendons are called sift tissues,…

Q: 22) If both married couples have the sickle cell trait (AS), what is the possible combination of…

A: The mode of inheritance is a pattern of obtaining parentral alleles  or genes to the offsprings. The…

Q: Low magnification High magnification rb b alv a air rbc Higher magnification: electron microscope a,…

A: Respiration is a process in which oxygen is inhaled by the body and carbon dioxide is exhaled. The…

Q: Mammalian lungs are very different in structure compared to amphibian lungs. The lungs of mammals…

A: The correct option is - (d) which is the respiratory membranes of mammals are able to diffuse gases…

Q: Let's take a closer look at the mandible, which is the only moveable bone in the skull. A process is…

A: Mandible is also called the lower jaw or lower jaw bone. It is the only movable bone in the human…

Q: A female Drosophila fly is heterozygous for three recessive pigmentation mutations called pk, bk,…

A: Gene expression is a process in which the genetic instructions of genes are utilized to manage…

Q: Directions: Read the paragraph and answer the questions. Write your answer on a separate paper.…

A: Answer 1- the mothers of 3 and 6 are carrying the gene of haemophilia as recessive alleles. They do…

Q: НО `CH2 В 2. Consider the structure of the disaccharide drawn at right: OH (a) Give the names and…

A: Carbohydrates are biomolecules that can be either monosaccharides, disaccharides, or…

Q: Digestive Enzyme Activity Tan-protease ...... - W-protease --- 4 8. 10 12 pH Based on these data and…

A: In this question, scientist identified two enzymes which are found to function in the digestive…

Q: When you examine the phenotype of wings - why can you conclude that wings & flight are analogous…

A: Change in visible characteristics of an organism which takes place from many generations is called…

Q: 1: The Chemistry of Life 7. Identify the molecule shown here: HỌC—CH,CH,CH,CH, CHỊCH,CH,…CH, CH, CH,…

A: The body of an organism is just like a chemical factory. Numerous chemical reactions are…

Q: Which of the following is the NOT the correct way of writing the scientific name? After the…

A: 1) There are precise conventions to follow while writing a scientific name. The genus name is…

Q: n tamarins were released into their natural habitat but found most were very underweight, presumably…

A: Gel electrophoresis is a technique used to separate DNA fragments according to their size. In order…

Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…

A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…

Q: Can you please answer this question 40

A: Alternative splicing is the process in which the mRNA is processed in such a way that one mRNA can…

Q: Examine the table showing the classification of four questions. Taxon Domain Kingdom Phylum Class…

A: Classification is the process of grouping things together based on shared characteristics. In…

Q: nswer any three.

A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…

Q: X-Linked Recessive Disorder: Color Blindness 3. Color blindness is an X-linked recessive disorder in…

A: An individual who suffers from color blindness is unable to distinguish between red and green…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Top layer -Middle layer Bottom layer Drag the labels to identify the components of whole blood after…

A: The blood is the liquid connective tissue that it mainly composed of plasma and blood corpuscles…

Q: Which of the following changes or mutations can be acted upon by natural selection? For each choice,…

A: Evolution is the gradual accumulation of changes in organisms over a period of time. The theory of…

Q: When eukaryotic genomes and prokaryotic genomes are compared, O the percentage of the genome devoted…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: 2. What happens when large natural and/or man-made deforestation occur?

A: 2. Deforestation is known as the purposeful clearing of forested land. Throughout history & into…

Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…

A: This question is about interpreting a scatter plot with a regression line from an experiment that…

Q: 53. A NURSE IS REVIEWING THE MEDICAL RECORD OF A CLIENT WHO HAS OSTEOPOROSIS AND HAS REQUESTED…

A: Note: Since you have posted multiple questions, we will provide the solutiononly to the first five…

Q: SQ_LESSON 4_DIFFERENTIATE AEROBIC AND ANAEROBIC RESPIRATION_WHAT'S NEW? What's More Directions: Fill…

A: In Aerobic respiration complete oxidation of glucose into CO2 and H2O takes place. In anaerobic…

Q: The collar bone is ___________ to the arms. Inferior Superior Lateral

A: Introduction Bones give structure to our body. In adult there are 206 bones are present. Bones along…

Q: 5.How does the simulation model natural selection?

A: Introduction Evolution is the change of biological populations' heritable features across…

Q: Now that you have learned about respiration and photosynthesis, how do aerobic respiration,…

A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…

Q: QUESTION 20 Wildebeest senrve as a keystone species because they.. provide a large income source due…

A: The keystone species have very important roles in the ecosystem. They help to define the entire…

Q: the base of the skull is the foramen magnum. This is where the spinal cord connects to the brain.…

A: The bones of the skeleton, which form the main longitudinal axis of the body in humans and other…

Q: 2. (A) What is the name of the key orexigenic neurons in the arcuate nucleus ARC. (B) These neurons…

A: The central nervous system (CNS) is one of the two major divisions of the nervous system. It…

Q: Which of the following is not true of diabetic retinopathy? retina blood vessels swell blood glucose…

A: Answer 1 Option C is correct :  Higher than normal HDL cholestrol levels

Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…

A: Water  It is the most important material on the planet eart. Water makes life possible as almost…

Q: For the following questions use the pedigree shown below: %3D 2 3 4 5 Assume that individual 1-2 is…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: What are some recommendations to clinicians interested in incorporating body composition methods in…

A: Introduction :- Body composition means that the chemical compounds that makes up the human body , in…

Q: One of the biggest obstacles to the widespread use of ultrasound for body composition estimation in…

A: Impedance is defined as the resistance to current flow. The bioimpedance devices/techniques employ…

Q: What organism did Vries used as evidence to prove that species did change as Darwin said? * evening…

A: Question number 1 On the basis of above observations, Hugo de Vries (1901) put forward a theory of…

Q: QUESTION ONE: The chart below illustrates key global environmental health challenges. Use the…

A: The chart shows critical global environmental well-being issues over 1,000 years in picture form. It…

Q: Look up "pseudohyphae" (or "pseudohypha") online and describe what they are in five words or less…

A: Psuedo hyphae: They are the hyphae that are formed due to incomplete cell division (or budding)…

Q: Question 1 (1 point) Which statement(s) about the lac operon in E. coli is correct? O A) It is an…

A: The lac operon in Escherichia coli (E. coli) is a well-known example of gene regulation in bacteria.…