1. Define the following terms according to your own understanding a. Climate b. Climate Change c. Global Warming 2. What are we going to do to lessen the impact of climate change in our country (Philippines)? How?

Q: Column A Column B mouth A. makes bile 2. large intestine B. produce juices in the mouth 3. liver C.…

A: The digestive tract or gastrointestinal tract (GIT) consists of hollow organs that are involved in…

Q: How u make it I want excel file or tell me how to make excel file now. U answered naa?? I will make…

A: The Lineweaver-Burk plot, also known as a double reciprocal plot, is a graphical representation of…

Q: What is this molecule? (Looks scary but look how it has those tails [Select] Which are highly polar?…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Your answer is incorrect please revise. Thanks

A: Bacterial infections can be harmful to the body as they can cause a range of symptoms and…

Q: ▾ Part A Penetrance specifically refers to the expression of lethal genes in heterozygotes. O True O…

A: Gene expression is a central process in biology that controls the development and functioning of…

Q: Find the pH of the equivalence points when 28.9 mL of 0.0850 M H₂SO3 is titrated with 0.0752 M NaOH.…

A: At the first equivalence point, all the H2SO3 is converted into its conjugate base, HSO3-. To…

Q: A microbiologist is testing an enzyme suspected to reduce the growth rate of a certain type of…

A:

Q: Select all that apply about 02 and CO2. O Both are nonpolar molecules. Both can diffuse passively…

A: The gases oxygen and carbon dioxide are critical components of the earth's atmosphere. This is…

Q: ituation #3: Bryan, together with his friend Rain, is curious about the liquid sample that they…

A: Feedback- Bryan and rain must not do the acrolein test if they wished to differentiate between…

Q: Modern maize is derived from teosinte, a weedy plant that grows in South and Central America. A key…

A: The question relates to the hereditary evolution of maize from its precursor, teosinte. The tb1 gene…

Q: What would likely result from a mutation in the lac operon promoter that increases the number of RNA…

A: RNA polymerase is the enzyme that polymerises messenger RNA (mRNA) over the DNA molecule. This…

Q: nple of a gain-of-function experiment? pholinos to test the function of MyoD e-targeting to test the…

A: Gain of function means when the foreign DNA is inserted in anyone of the concerned cells, the gene…

Q: 1. How are genes inserted into the cancer cells? 2. What is the most common form of gene therapy? 3.…

A: 1. With the help of small glass pipette, a solution having new DNA is pricked into the cell. This…

Q: Can you please show me step by step how you were able to solve this problem?

A: Clindamycin is an antibiotic medication and is used for the treatment of infections such as pelvic…

Q: Question 9 What is the driving factor for ATP production in ATP Synthase? O protons going through…

A: ATP synthase is an enzyme that produces adenosine triphosphate (ATP) directly during the process of…

Q: 21). It is Review coupled reactions Me useful and customary to express the number of GTP, UTP, or…

A: Gluconeogenesis is the process that involves generation of glucose from non-carbohydrate sources…

Q: Hello! By what process can I arrive at the answer? Please be detailed on the problem should be done,…

A: Redox reactions occur in living cells. Redox reactions involve oxidation as well as reduction. In…

Q: 4. Explain the techniques in cancer therapy. 5. Why is gene therapy not a common treatment of…

A: Cancer is a condition caused by a mutation in the genome that results in infinite cell…

Q: 3) The best way to avoid the bends is to O equalize the pressure on your ears. continually exhale as…

A: Blood stream is defined as the term that refers the flow of blood through out the human body. The…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: If you want to deliver 500. mL of a 5.0% glucose solution over a 3.0 hour time period using an IV…

A: Volume = 500ml Time = 3hr =180 mint Drop factor =20gtt/ml Flow rate =total volume in ml/Time in…

Q: Shown below is the structure of Drug 1, that binds to the E. coli ribosome. Indicate whether each…

A: Since, you have asked multiple questions from multiple concepts, we have answered all 4 subparts of…

Q: B. Pick any three different amino acids, link them together with peptide bonds, and draw the…

A: Amino acids are organic molecules containing an amino group and an acidic group hence the name amino…

Q: 18. Which one of the following factors should be on the x-axis of the graph to accurately describe…

A: Enzymes are the biological catalysts that fasten the rate of chemical reactions. They are neither…

Q: Which of the following statements about hormones is false? Hormones and the endocrine system…

A: Hormones are the chemical messenger secreted by the endocrine glands into the blood circulation…

Q: Marlene Zuk and her colleagues' work on the field cricket T. oceanicus provided insights into how…

A: Natural selection drives the process of evolution.

Q: filled with Plasma membrane Material for secretion wwwww Secretory vesicle cell membrane forms…

A: Above two incomplete phrases are related to the processes of transport of macromolecules across the…

Q: Why the MRNA is usually enclosed in a lipid vesicle,in an mRNA vaccine?

A: mRNA vaccines are composed of an invitro synthesized  mRNA that codes for the antigen of interest…

Q: Which of the following statements about cholesterol is not correct? (3 pts) CH3 CH3 H но Cholesterol…

A: Cholesterol is a steroid consisting of 4 fused hydrocarbon ring and one hydroxylated hydrocarbon…

Q: Name(s) How many? Function Name(s) How many? Function Name(s) How many? Function Name(s) How many?…

A: Plants are multicellular eukaryotic organisms which are autotrophic in nature that means they make…

Q: In oldfield mice, did developmental experience (helping raise one's own parents raise broods of…

A: Alloparenting is used to explain the form of care that is provided by an individual towards other…

Q: Identify the components of skin in the accompanying diagram. а. Hair b. Sebaceous glands С. d. Sweat…

A: Skin is a layer of usually soft, flexible exterior tissue that covers a vertebrate animal's body and…

Q: Which of the following statements about learning is false? Natural selection can operate on the…

A: Introduction: The theory of natural selection was given by Sir Charles Darwin in the year 1859.

Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…

A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…

A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…

Q: Which of the following parts of a neuron is correctly matched? (Select all that apply)…

A: Neurons, also known as nerve cells, are the fundamental units of the brain and nervous system. They…

Q: Primary Succession Greatest Biodiversity Little Biodiversity Climax Community What is happening to…

A: Primary succession is a very slow process and begins where no ecosystem existed before. It starts on…

Q: What is the term for the material in the nucleus during Interphase? What is this?

A: Meiosis is the process of cell division that separates homologous chromosomes. Following are the…